ID: 1049015414

View in Genome Browser
Species Human (GRCh38)
Location 8:139916503-139916525
Sequence CGTTCCGAGGAGTGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049015414_1049015421 -2 Left 1049015414 8:139916503-139916525 CCCTCCATCCACTCCTCGGAACG 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1049015421 8:139916524-139916546 CGCGGCACTCCGCGGCCTCCCGG No data
1049015414_1049015422 -1 Left 1049015414 8:139916503-139916525 CCCTCCATCCACTCCTCGGAACG 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1049015422 8:139916525-139916547 GCGGCACTCCGCGGCCTCCCGGG No data
1049015414_1049015420 -10 Left 1049015414 8:139916503-139916525 CCCTCCATCCACTCCTCGGAACG 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1049015420 8:139916516-139916538 CCTCGGAACGCGGCACTCCGCGG No data
1049015414_1049015423 6 Left 1049015414 8:139916503-139916525 CCCTCCATCCACTCCTCGGAACG 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1049015423 8:139916532-139916554 TCCGCGGCCTCCCGGGTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049015414 Original CRISPR CGTTCCGAGGAGTGGATGGA GGG (reversed) Intronic
901125464 1:6925612-6925634 GGTACCAAGGAGTGGCTGGAGGG - Intronic
901814717 1:11787618-11787640 CATTCCGAAGAGGGAATGGATGG - Exonic
907767137 1:57423262-57423284 GGTGCTGGGGAGTGGATGGAGGG + Intronic
910908006 1:92202220-92202242 CGTTCTGAGGAGTGCATGGGTGG + Intergenic
914802910 1:150973981-150974003 CGTTATGAGGTGTGGATGGCTGG - Intronic
918263499 1:182818543-182818565 CGTGCTGAGGAGTTGTTGGATGG + Exonic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
1074462186 10:113647885-113647907 CCTTTCTGGGAGTGGATGGATGG - Intronic
1074464268 10:113667833-113667855 AGTGCAGAGGAGTGGACGGATGG - Intergenic
1076720385 10:132389830-132389852 CTCTCCGAGGTGTGGTTGGAGGG - Intergenic
1078408235 11:11089817-11089839 AGCTCCAAGGGGTGGATGGAAGG + Intergenic
1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG + Intronic
1079882564 11:25944861-25944883 AGTGCTAAGGAGTGGATGGACGG + Intergenic
1081485015 11:43520834-43520856 AGCTCCAATGAGTGGATGGATGG - Intergenic
1083179744 11:60977471-60977493 AGTGCCGAGGACAGGATGGAGGG - Intronic
1085322340 11:75583007-75583029 TGTGCCGCTGAGTGGATGGATGG - Intergenic
1087270867 11:96110166-96110188 TGTTTTGAGGAGTGGATGGAAGG + Intronic
1088940751 11:114453454-114453476 CCTCCTGAGGAGTGGTTGGAAGG - Intergenic
1095801927 12:46278152-46278174 GGTGCCCAGAAGTGGATGGAGGG - Intergenic
1097865847 12:64558693-64558715 CTTTCTGAGGAGTGGCTGTAAGG + Intergenic
1098542055 12:71667656-71667678 AGTGCCTAGGAGTGCATGGATGG - Intronic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106171611 13:27293433-27293455 CCTTCCGATGAAAGGATGGAGGG - Intergenic
1121608116 14:95256215-95256237 GGTGCCGAGGAGTGGGTGGCGGG - Intronic
1127688884 15:61375449-61375471 CATACCTAGGAGTGGATGGTTGG + Intergenic
1131131090 15:89900983-89901005 CGTTCCCAGGCGTGGCTGGCTGG - Exonic
1142225498 16:88875317-88875339 AGTTGAGAGGAGTGGAGGGAGGG + Exonic
1142605530 17:1079026-1079048 CGTGGCGAGGAGAGGAGGGAAGG + Intronic
1151153830 17:72110613-72110635 AGAGCTGAGGAGTGGATGGAAGG + Intergenic
1151543185 17:74775947-74775969 AGTTCTGGGGAGTGGACGGAAGG - Intronic
1152115213 17:78382218-78382240 GGTACCGAGTAGGGGATGGAGGG + Intronic
1152331752 17:79677628-79677650 GGTTCCCAGGAGTGGAGTGAGGG + Intergenic
1161578054 19:5065761-5065783 CGTGCAGAGGAGGGGATGGATGG - Intronic
1163364586 19:16868927-16868949 CCTTCCGGGTAGTAGATGGAGGG + Intronic
1164864494 19:31592580-31592602 CCTTCCGAGGTGTGAAGGGAAGG + Intergenic
1168018955 19:53594962-53594984 CGCACTGAGGAGGGGATGGATGG - Intergenic
1168707121 19:58476549-58476571 CGTTGCGCGGAGTCGAGGGATGG - Intronic
925161535 2:1687412-1687434 CGTCCTGAGGGGTGGGTGGAGGG + Intronic
925270983 2:2607211-2607233 CATTCCGAGGAGTGTATTTAAGG - Intergenic
926861404 2:17313608-17313630 CGTTTGGAGGAGGGGGTGGATGG + Intergenic
927626817 2:24730255-24730277 CTTTCCTAGGAGAGGAAGGATGG - Intronic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
928360637 2:30659603-30659625 TGTTTCCAGGAGTGGAAGGAGGG + Intergenic
929539977 2:42811589-42811611 CGTTCAGAGAAATGGATGGAGGG + Intergenic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
932495192 2:72142725-72142747 AGTTCTGGGGAGTGGCTGGAAGG - Intronic
936550525 2:113435085-113435107 GGTTCCCAGGAGTGGAGGGCTGG - Intergenic
937846874 2:126588326-126588348 CACTCAGAGGAGTGGATTGAGGG - Intergenic
946378935 2:219331677-219331699 CGTTCCCAGGACTGGTGGGAAGG + Intronic
1170155267 20:13263345-13263367 CGATCCTAGGAGTGGAAGCAGGG - Intronic
1170794665 20:19536153-19536175 AGTACTGAGGAGTGGATTGAGGG - Intronic
1172208642 20:33182102-33182124 CATTCTGGGGTGTGGATGGAGGG - Intergenic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1185012219 22:48320718-48320740 AGTTTCCAGGAGTGGAGGGAAGG - Intergenic
949785532 3:7736698-7736720 ATTTCCTATGAGTGGATGGAGGG + Intronic
950521344 3:13499788-13499810 GGTTCCGAGGAGGGCCTGGATGG + Intronic
950667797 3:14507697-14507719 AGTCCTGAGGAGTGGATGCAGGG + Exonic
956718980 3:72101553-72101575 AGTTCCAAAGAGTTGATGGAGGG - Intergenic
956761126 3:72446621-72446643 CCTTCCGAGGAGTGGAGAGTGGG + Exonic
969685538 4:8672054-8672076 AGTTCCTGGGAGTGGCTGGAGGG + Intergenic
972766902 4:42159634-42159656 CATTCCAAAGAGAGGATGGAGGG - Intergenic
973181898 4:47279073-47279095 CTTTCTTAGGAATGGATGGATGG + Intronic
975998157 4:80340338-80340360 AGTTCTGAGTATTGGATGGAAGG - Intronic
976000342 4:80367031-80367053 GTTTCCAAGGACTGGATGGAAGG + Intronic
984722578 4:182989536-182989558 GGTTCCTGGGAGTGGAAGGAGGG + Intergenic
986980568 5:13443844-13443866 ATTTCCTAGGAGTCGATGGATGG - Intergenic
990333067 5:54746211-54746233 CTTGCTGAGGAGTGGATGGGTGG + Intergenic
1004093143 6:12525912-12525934 CGGTCTGAGGTTTGGATGGATGG - Intergenic
1013635864 6:112028645-112028667 AGTTCTGAGGGCTGGATGGAAGG - Intergenic
1022339637 7:29456192-29456214 CGTTCAGAGGAGCAGATGGGAGG - Intronic
1031063223 7:117075514-117075536 CATCCAGAGGAGTGGATGGCAGG - Intronic
1032709785 7:134451559-134451581 CGTTCCGCGGTGGGGCTGGAAGG - Intronic
1040567778 8:48582607-48582629 CGCTCCGGGGAGGGGAGGGAGGG + Intergenic
1041724220 8:61003292-61003314 GGTTCTGGGGAGTGGATAGAGGG + Intergenic
1046846103 8:118918303-118918325 GGTTGCTAGGAGTTGATGGAGGG + Intergenic
1049015414 8:139916503-139916525 CGTTCCGAGGAGTGGATGGAGGG - Intronic
1049902412 9:181738-181760 GGTTCCCAGGAGTGGAGGGCTGG + Intergenic
1056304660 9:85278020-85278042 TGTTCTGGGGAATGGATGGAAGG - Intergenic
1057389963 9:94634652-94634674 CTCTCCCAAGAGTGGATGGAGGG + Intronic
1060139920 9:121201361-121201383 CGCTCCGAGGCGTGCAGGGAAGG - Intronic
1060312184 9:122472054-122472076 CGTTCCCAGGATTGGATTTAGGG - Intergenic
1062504423 9:136865936-136865958 CGGACCCAGGAGGGGATGGACGG - Intronic
1198096323 X:133383403-133383425 GGTTGCCAGGAGTTGATGGAAGG + Intronic