ID: 1049015879

View in Genome Browser
Species Human (GRCh38)
Location 8:139919762-139919784
Sequence TGGGCCACACACTGGTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049015879_1049015887 10 Left 1049015879 8:139919762-139919784 CCATGCTACCAGTGTGTGGCCCA 0: 1
1: 0
2: 2
3: 14
4: 121
Right 1049015887 8:139919795-139919817 GGAGGACCCCATGCACAGGAAGG No data
1049015879_1049015892 23 Left 1049015879 8:139919762-139919784 CCATGCTACCAGTGTGTGGCCCA 0: 1
1: 0
2: 2
3: 14
4: 121
Right 1049015892 8:139919808-139919830 CACAGGAAGGCAGTGGCTTGAGG No data
1049015879_1049015886 6 Left 1049015879 8:139919762-139919784 CCATGCTACCAGTGTGTGGCCCA 0: 1
1: 0
2: 2
3: 14
4: 121
Right 1049015886 8:139919791-139919813 GTGCGGAGGACCCCATGCACAGG No data
1049015879_1049015889 16 Left 1049015879 8:139919762-139919784 CCATGCTACCAGTGTGTGGCCCA 0: 1
1: 0
2: 2
3: 14
4: 121
Right 1049015889 8:139919801-139919823 CCCCATGCACAGGAAGGCAGTGG No data
1049015879_1049015893 24 Left 1049015879 8:139919762-139919784 CCATGCTACCAGTGTGTGGCCCA 0: 1
1: 0
2: 2
3: 14
4: 121
Right 1049015893 8:139919809-139919831 ACAGGAAGGCAGTGGCTTGAGGG No data
1049015879_1049015883 -8 Left 1049015879 8:139919762-139919784 CCATGCTACCAGTGTGTGGCCCA 0: 1
1: 0
2: 2
3: 14
4: 121
Right 1049015883 8:139919777-139919799 GTGGCCCAGAGCAGGTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049015879 Original CRISPR TGGGCCACACACTGGTAGCA TGG (reversed) Intronic
900567666 1:3341699-3341721 TGGGCCACAAATTGATAGCTGGG - Intronic
901752939 1:11422839-11422861 TGAGACACACACTGCTGGCACGG + Intergenic
902925223 1:19691538-19691560 TGAGCCACACTGTGGTGGCACGG + Intronic
905533121 1:38697934-38697956 TGTGCCAAACACTGCTATCAAGG + Intergenic
910509189 1:87984747-87984769 TGGGCCACCCACAGGTAGGAAGG - Intergenic
913228429 1:116720812-116720834 GGTGGCACACACTGGGAGCATGG - Intergenic
915482264 1:156194962-156194984 TGGTCCACAGACTGGCATCATGG - Intronic
915559034 1:156675892-156675914 TGGGCCACACAGAGGTGCCATGG - Intronic
919090813 1:192977245-192977267 TGGGCCACAGACTGGTACCAGGG + Intergenic
919883345 1:201915381-201915403 TGGGCCAGACACTACTAGGAAGG + Intronic
924420555 1:243905475-243905497 TGGGCCAGACACCAGCAGCAAGG - Intergenic
1062939110 10:1408788-1408810 ACGGCCACACACTGGTAGCTGGG + Intronic
1069249167 10:66246172-66246194 TGGGCACCACACTGAGAGCAGGG + Intronic
1070603122 10:77879371-77879393 TGGGCCACACAGAGGATGCAGGG + Intronic
1070819907 10:79348475-79348497 TCGGCCACACATTGACAGCAGGG + Intronic
1075798231 10:125135893-125135915 TGCCCCACAGACTGGGAGCAGGG - Intronic
1077933373 11:6756825-6756847 TGGCCCTCACACAGGGAGCAGGG - Intergenic
1078360661 11:10665267-10665289 TGGGCCCACCAATGGTAGCAGGG - Intronic
1081064058 11:38518108-38518130 TGAGCCACACACTTGCAACATGG + Intergenic
1081336956 11:41878779-41878801 TGAGACACACTCTGGGAGCAGGG - Intergenic
1083731595 11:64655256-64655278 TGGGCCACAGCCTGGCACCAAGG + Intronic
1087670522 11:101100850-101100872 TGGGCCACATAATTGTTGCAGGG - Intronic
1087944181 11:104138518-104138540 TGGTCCACAAACCTGTAGCATGG + Intronic
1089673192 11:120071455-120071477 TGGCCCAGACTCAGGTAGCAAGG - Intergenic
1091584753 12:1809859-1809881 TGGGCCCCACAATGGTAGAAAGG + Intronic
1091752774 12:3032997-3033019 TTGGCCACACACAGTTAGGAAGG + Intronic
1091965391 12:4736406-4736428 TGACCCACATACTGGTAGCTTGG - Intronic
1096095906 12:48935513-48935535 GGAGCCAGACACTGGTAGCAGGG + Intronic
1098486315 12:71025895-71025917 GGGAGCACACACTGGCAGCATGG + Intergenic
1102530660 12:113544072-113544094 TGGGTCACACACTGGTAAGGTGG + Intergenic
1104822742 12:131687585-131687607 TGCGCCCCACACTGGTAGGCTGG + Intergenic
1104888996 12:132130751-132130773 TGAGCCACACCCTGGCAGCCTGG - Intronic
1105885766 13:24639723-24639745 TGGCCTACACACTGGGAGGAGGG - Intergenic
1105969494 13:25415240-25415262 GGGGCCACATACTGGATGCATGG - Intronic
1106702606 13:32246088-32246110 TGGGGCACACATTCGTAGAAAGG - Intronic
1110016557 13:70413272-70413294 AGGGCCACACATTGGTAGTAGGG - Intergenic
1114650029 14:24278804-24278826 TGGGCCACACACTCCTCACAGGG - Intergenic
1119705444 14:76780053-76780075 TGGGCCAGTCACTTGTGGCAGGG + Exonic
1121278711 14:92685312-92685334 CTGGACACACACTGGCAGCAGGG - Intronic
1121757729 14:96417078-96417100 TGGGCCAGTCACAGGGAGCAAGG + Intronic
1121993689 14:98585089-98585111 TGGGACACATGCTGGAAGCAGGG + Intergenic
1123040476 14:105488266-105488288 TGGGACCCACCCTGGTGGCAGGG + Intronic
1125509580 15:40285751-40285773 TGGGCCACACACAGGTTCCAGGG - Intronic
1129227654 15:74179341-74179363 TGGGCCAGACACTGGGTGGAAGG - Intergenic
1129966617 15:79741955-79741977 TTGGGCACTCACAGGTAGCATGG + Intergenic
1133521612 16:6563708-6563730 GGTGGCACACACTGGTAGTAGGG + Intronic
1137272591 16:46912114-46912136 TGGACCACACACTGTGACCAGGG + Intronic
1137481326 16:48854077-48854099 TGGCTCACAGACTGGAAGCAAGG - Intergenic
1149040998 17:52187906-52187928 TGGGCCACTAACCGGTACCATGG - Intergenic
1149101016 17:52907162-52907184 TAGGCCACACACTGAGAGTATGG - Intergenic
1149473138 17:56935749-56935771 TGGGCCACGCACTCATAGTAAGG + Intergenic
1150594222 17:66590104-66590126 GGGGCCATACACTGGCAGCTGGG + Intronic
1152333100 17:79684918-79684940 GGGGCCACACAGTGGCAGCCAGG + Intergenic
1152821002 17:82437595-82437617 TGCGGCGCACACGGGTAGCATGG - Intronic
1155561342 18:27080678-27080700 TGAGCCACACACTGGAACTAGGG + Intronic
1156796987 18:41058019-41058041 TAGGCCACACAAATGTAGCAAGG - Intergenic
1158832003 18:61289920-61289942 TGTGCTACACACAGTTAGCATGG + Intergenic
1159770779 18:72543587-72543609 TTGGCCACGCGCTGGGAGCAGGG - Intronic
1164770731 19:30806858-30806880 TGGACCTCCCACTGGTAGGAAGG + Intergenic
1165468610 19:35989985-35990007 TGGGCCACACAGTGGTTAAAGGG - Intergenic
1165791160 19:38493421-38493443 TGGGCCAGGCACTGTTACCAGGG + Intronic
1166097016 19:40546517-40546539 TGGGTCACATTCTGGAAGCAAGG + Intronic
1167140515 19:47647612-47647634 TGGGCCACACACACGTGCCAAGG - Intronic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
926985852 2:18622456-18622478 TGTGCCAGAAATTGGTAGCATGG - Intergenic
927064513 2:19457798-19457820 AGGGCCACACACAGGAAGAAAGG - Intergenic
930624842 2:53685553-53685575 TGGGCCACAAAACTGTAGCAGGG - Intronic
931097522 2:58957956-58957978 TGGCGCACACCCTGGGAGCACGG + Intergenic
934663399 2:96154792-96154814 TGGGCCAGGCACTGGCATCAGGG - Intergenic
935736629 2:106111572-106111594 GTGGCCACACAGTGGTAGCCTGG - Intronic
937460193 2:122078823-122078845 TGGGCCAGACCCTGTTAGCCTGG + Intergenic
938199799 2:129363336-129363358 TGGGCCACACTCTGCTCTCAAGG + Intergenic
942190377 2:173463432-173463454 AAAGGCACACACTGGTAGCAGGG + Intergenic
1168813885 20:723575-723597 TGTGCCACACACTGGCTGCGTGG + Intergenic
1170886287 20:20342725-20342747 TGGGGCACGCACTGGGAACAGGG - Intronic
1173286060 20:41672349-41672371 TCTGCCCCACACTGGAAGCAAGG + Intergenic
1175216255 20:57392944-57392966 TGGGCCACACGCTGTGAGAAGGG - Intronic
1176064778 20:63188776-63188798 TGGGCCCCACTGTGGGAGCACGG - Intergenic
1176184177 20:63769190-63769212 TGGGCCAAACACTTGGGGCATGG - Intronic
1177596047 21:23244527-23244549 TAGTCCACACACTGTTATCAGGG + Intergenic
1178508236 21:33180505-33180527 AGGGTCACACACTGGAATCATGG - Intergenic
1181720826 22:24773133-24773155 TGGGCCACACATTGGCAGCTGGG + Intronic
1181853492 22:25766662-25766684 TGGGCAACAGCCTGGAAGCAGGG + Intronic
1182267507 22:29129568-29129590 TGCGAGCCACACTGGTAGCAGGG - Intronic
1182879385 22:33720420-33720442 TAGGCCACGGACTGGTACCAGGG + Intronic
1183014639 22:34975846-34975868 TGGTCCACGGACTGGCAGCATGG - Intergenic
1183192915 22:36333094-36333116 TGGGACACACACAGGGAGCATGG + Intronic
1184260818 22:43314773-43314795 TGCGCCAGAAAGTGGTAGCATGG - Intronic
1184785544 22:46669959-46669981 TGGGCCACACACTGGCATGTGGG + Intronic
950636805 3:14321262-14321284 TGGGCCACCCACTGTTGGCATGG + Intergenic
952958846 3:38577198-38577220 CGGGCAACACACAGGCAGCAAGG + Intronic
959728564 3:109573937-109573959 TTGGCTAAACACTGGTAACATGG - Intergenic
962954550 3:140252378-140252400 TGGTCCACAGACTAGCAGCATGG + Intronic
963083419 3:141415444-141415466 TGGTCCTCAGACTGGCAGCATGG + Intronic
963286459 3:143438780-143438802 TGGGCCAGTCACTGGTAACTCGG - Intronic
965529796 3:169760038-169760060 TAGGCCTCAAACTGGTAGGATGG + Intergenic
966358483 3:179107873-179107895 CAGGCCACAGACTGGTACCAGGG + Intergenic
970301269 4:14683806-14683828 TGGGCCTCACACTGTTAGCCTGG + Intergenic
972663386 4:41140597-41140619 CAGGCCACAGACTGGTACCAGGG - Intronic
973017785 4:45163334-45163356 CGGGCCACAGACTGGTACCGTGG - Intergenic
977084554 4:92576660-92576682 TGTGTCAGACACTGGTGGCATGG + Intronic
983813456 4:172093513-172093535 TGGGCCACAGACTGGTACCATGG + Intronic
986438579 5:7759022-7759044 TGGGCCAAGCACTAGCAGCAGGG + Intronic
988710865 5:33773428-33773450 CAGGCCACAGACTGGCAGCAGGG - Intronic
991420593 5:66437405-66437427 CAGGCCACAAACTGATAGCAGGG - Intergenic
997621434 5:135299805-135299827 TGTGGCACACACAGGTAGAATGG + Intronic
999130413 5:149278714-149278736 TGGGCCAGGCACTGGGAGCTAGG - Intronic
1001651166 5:173317471-173317493 TGGGCCACACAGTGGGTGCTGGG - Exonic
1003131531 6:3399123-3399145 TGGCCCAGACTCTGGAAGCAGGG - Intronic
1003583587 6:7365343-7365365 AGGGTCACACACTGGCATCATGG - Intronic
1003771176 6:9302984-9303006 TGAGCCCCACAATGGAAGCAGGG - Intergenic
1006454217 6:34122763-34122785 TGGGCCAGGCACTGGAAGTAGGG + Intronic
1011521218 6:88208990-88209012 TGGGCCAATCACTGGGACCAGGG - Intergenic
1011775218 6:90722289-90722311 TGGGCCATACACTGGGTGCCTGG - Intergenic
1018931313 6:168242117-168242139 TGGGGTGCACACTGGCAGCACGG + Intergenic
1019328335 7:450690-450712 TGGGCTCCACACAGGTAGCGGGG - Intergenic
1023471144 7:40521404-40521426 TGGGCTACACAATGGAGGCAGGG + Intronic
1024229665 7:47354537-47354559 TGGGCCTCAGGCTGGGAGCAGGG - Intronic
1024883617 7:54116690-54116712 TGGAGCACACACTGGTAGAAAGG + Intergenic
1025179440 7:56817501-56817523 TGGGCCGCACACTGGCTGCTGGG + Intergenic
1028933798 7:96443217-96443239 TGGGCCACAGATTAGTAGCAGGG - Intergenic
1030392788 7:108947802-108947824 TGGGCCTCAGAATGGAAGCAAGG - Intergenic
1033830473 7:145245535-145245557 TGGGACAGACATTGATAGCATGG + Intergenic
1034447020 7:151118925-151118947 TGGGCCATCCACAGGTGGCATGG + Intronic
1034697699 7:153068696-153068718 TGGGGCACAATCTGGAAGCAAGG + Intergenic
1041372326 8:57174953-57174975 TTAGCCACACAGTAGTAGCAGGG + Intergenic
1049015879 8:139919762-139919784 TGGGCCACACACTGGTAGCATGG - Intronic
1051295706 9:15593208-15593230 ATGTCCACACAATGGTAGCATGG - Intronic
1051807427 9:21011031-21011053 TGGGCCACAGACTGGGATCATGG + Intronic
1054741659 9:68811941-68811963 GGGGCCACACACTGAAACCAGGG - Intronic
1056320537 9:85430793-85430815 TGGGCCGCACAAAGGTAGCGGGG + Intergenic
1058281932 9:103127049-103127071 TGGCCCACACAGTGGGAGGATGG - Intergenic
1059347996 9:113645335-113645357 CAGGCCACAGACTGGTACCAGGG - Intergenic
1185794026 X:2949516-2949538 TTGCCCTCACACTGGTAGCAGGG - Exonic
1189245550 X:39560765-39560787 TGGGCCACACCTTGGTGGCCAGG - Intergenic
1195039488 X:101001259-101001281 TGGGCCACACGCTGTTACCTAGG + Intergenic
1196491010 X:116266690-116266712 TGAGGAACACACTGGTAACATGG - Intergenic
1200398289 X:156003931-156003953 TGGGCCACTCACAGGCTGCAAGG - Intronic