ID: 1049015997

View in Genome Browser
Species Human (GRCh38)
Location 8:139920510-139920532
Sequence CTGCCTACACAGTGGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049015990_1049015997 8 Left 1049015990 8:139920479-139920501 CCTCCCTCCTGGTCTGTAAAGAA 0: 1
1: 0
2: 1
3: 21
4: 230
Right 1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG No data
1049015989_1049015997 14 Left 1049015989 8:139920473-139920495 CCTGAGCCTCCCTCCTGGTCTGT 0: 1
1: 0
2: 0
3: 58
4: 432
Right 1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG No data
1049015985_1049015997 21 Left 1049015985 8:139920466-139920488 CCCTGTCCCTGAGCCTCCCTCCT 0: 1
1: 1
2: 7
3: 67
4: 756
Right 1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG No data
1049015994_1049015997 1 Left 1049015994 8:139920486-139920508 CCTGGTCTGTAAAGAAAGGAGCC 0: 1
1: 0
2: 0
3: 7
4: 234
Right 1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG No data
1049015993_1049015997 4 Left 1049015993 8:139920483-139920505 CCTCCTGGTCTGTAAAGAAAGGA 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG No data
1049015991_1049015997 5 Left 1049015991 8:139920482-139920504 CCCTCCTGGTCTGTAAAGAAAGG 0: 1
1: 0
2: 1
3: 21
4: 173
Right 1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG No data
1049015988_1049015997 15 Left 1049015988 8:139920472-139920494 CCCTGAGCCTCCCTCCTGGTCTG 0: 1
1: 0
2: 4
3: 34
4: 424
Right 1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG No data
1049015986_1049015997 20 Left 1049015986 8:139920467-139920489 CCTGTCCCTGAGCCTCCCTCCTG 0: 1
1: 1
2: 3
3: 81
4: 749
Right 1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049015997 Original CRISPR CTGCCTACACAGTGGCAGCC AGG Intronic
No off target data available for this crispr