ID: 1049016527

View in Genome Browser
Species Human (GRCh38)
Location 8:139924017-139924039
Sequence CCGAGCACGGGGAGGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049016517_1049016527 4 Left 1049016517 8:139923990-139924012 CCTTGCAAACAATCAACAAGGTC 0: 1
1: 0
2: 1
3: 6
4: 152
Right 1049016527 8:139924017-139924039 CCGAGCACGGGGAGGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049016527 Original CRISPR CCGAGCACGGGGAGGGGGCA TGG Intronic
No off target data available for this crispr