ID: 1049017309

View in Genome Browser
Species Human (GRCh38)
Location 8:139929908-139929930
Sequence TCCATTTTACAGGACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049017309_1049017312 -4 Left 1049017309 8:139929908-139929930 CCTTCCATGTCCTGTAAAATGGA 0: 1
1: 0
2: 0
3: 24
4: 181
Right 1049017312 8:139929927-139929949 TGGAGCAAGCACCACCTTGTAGG No data
1049017309_1049017314 9 Left 1049017309 8:139929908-139929930 CCTTCCATGTCCTGTAAAATGGA 0: 1
1: 0
2: 0
3: 24
4: 181
Right 1049017314 8:139929940-139929962 ACCTTGTAGGTGCAGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049017309 Original CRISPR TCCATTTTACAGGACATGGA AGG (reversed) Intronic
900698859 1:4031640-4031662 TCTATTTTTCAGGGCATGGTGGG + Intergenic
901340467 1:8494285-8494307 TTTATTTTAAAGCACATGGAGGG - Intronic
902449439 1:16487328-16487350 TCCAATTTACAGGAAATACATGG + Intergenic
902469082 1:16635913-16635935 TCCAATTTACAGGAAATACATGG + Intergenic
902505043 1:16933988-16934010 TCCAATTTACAGGAAATACATGG - Intronic
904668079 1:32139540-32139562 TCCATTTTACAGGAAATACAAGG + Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905368572 1:37470102-37470124 TCCAGTGTACAGGAAAGGGAAGG + Intergenic
905692565 1:39954406-39954428 CCCATTTTACAGCACAGGAAGGG - Intergenic
907710897 1:56880249-56880271 TCCATGTTTTAGGATATGGATGG - Intronic
908273040 1:62438643-62438665 CCTATTTTTCAGGACATGGGAGG - Intronic
908695707 1:66839139-66839161 TCCTATTTACAGGACAGGAATGG + Intronic
910439371 1:87237000-87237022 TGCCTTTTAAAGGACTTGGAGGG - Intergenic
911466568 1:98261830-98261852 TGCATGTTAGAGGACATGGTGGG - Intergenic
911617609 1:100031978-100032000 TCCAGTTCAAAGGACATGAAAGG - Intergenic
913026086 1:114842117-114842139 GCCATTTTCCAGAACATAGAAGG + Intergenic
913081305 1:115389513-115389535 TCCATTTAAGAGAAAATGGATGG - Intergenic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
915763990 1:158344428-158344450 TGCCCTTTATAGGACATGGATGG - Intergenic
916425740 1:164677969-164677991 TCCATTTTAAAGAAAATGTATGG + Intronic
917187171 1:172371581-172371603 TACATTTTATAGGACAGGGCAGG - Intronic
919220179 1:194618006-194618028 ACCAATTGACAGGACATGGGCGG + Intergenic
921584501 1:216931430-216931452 TCCATTTTCCAGAATAAGGAAGG - Intronic
921730201 1:218569591-218569613 ACCCTTGTTCAGGACATGGAAGG - Intergenic
922469445 1:225866870-225866892 TTCATTTGTCAGGACAGGGATGG - Intronic
924875412 1:248097816-248097838 TCCAATTTCCAGGACATGTTGGG + Intronic
1068728313 10:60327535-60327557 ACCATTTAAGAGGACAGGGAGGG - Intronic
1072780248 10:98245884-98245906 TCCATTTGAAAGGAAATGCAGGG + Intergenic
1073028538 10:100506518-100506540 TGCATTTTATAGGGCATGGATGG - Intronic
1085085814 11:73666042-73666064 TCCATTTTAGAGGGCATCGAGGG - Intergenic
1086326761 11:85709262-85709284 TCAATCTTACAGGAATTGGAAGG - Intronic
1090628966 11:128629587-128629609 CCTGTTTTACAGGATATGGAGGG - Intergenic
1090646780 11:128772865-128772887 TCCTTTTTCCAGAACATGGATGG + Exonic
1091470242 12:720159-720181 TCCATTTTTCAGCAAAGGGATGG - Intergenic
1091822085 12:3483085-3483107 CCCATTTTACAGATCACGGAAGG - Intronic
1093086505 12:14871194-14871216 TCCATTTTACAGCCCAGAGATGG - Intronic
1093811862 12:23501642-23501664 TCCATTCTACAAGACATTGATGG - Intergenic
1094300101 12:28955010-28955032 TCAATTTTCAAGGTCATGGAAGG - Intergenic
1095854597 12:46845923-46845945 TCCATTTTACAGGTAATTGAAGG + Intergenic
1096679435 12:53245549-53245571 TCCATTTAACAGGAAATACAGGG + Intergenic
1098026290 12:66206102-66206124 TCCATTTTATATGACAATGAAGG + Intronic
1098930208 12:76403428-76403450 TCCATTTTACAAATCATGAAAGG + Intronic
1102645636 12:114401910-114401932 TCCTTCTTGCAGGGCATGGAGGG - Exonic
1103714431 12:122935711-122935733 TCTTTTTTTCAGGACAGGGATGG - Intronic
1104125998 12:125846673-125846695 TCCATTATTCAGTAAATGGATGG - Intergenic
1105566950 13:21558801-21558823 TCCATTTCACAGGTGAGGGATGG + Intronic
1106087135 13:26553388-26553410 TCCATTTTATAGGCTATGCACGG + Intergenic
1106803503 13:33281659-33281681 TCCATGTTATAGCACATGGCAGG - Intronic
1109584035 13:64374514-64374536 TCCATTTCACAGGGCCGGGAAGG + Intergenic
1109625119 13:64963725-64963747 ACAATGTTACAGGATATGGATGG + Intergenic
1110072524 13:71195226-71195248 TGCACTTTATAAGACATGGATGG - Intergenic
1110242689 13:73286450-73286472 TGCATTTTAAAGGACAGGCAGGG - Intergenic
1113308393 13:109104235-109104257 CTCATATTACAGGACTTGGAAGG + Intronic
1113656428 13:112070625-112070647 TCCATACTCCAGGACAAGGAAGG - Intergenic
1114639407 14:24209273-24209295 CCCATTTTCAAGGACAAGGAGGG - Intronic
1115215609 14:31011082-31011104 TCCATTTCCCATGACAGGGAGGG + Intronic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1118899180 14:69972507-69972529 TCAGTTTTATAGGACTTGGAAGG + Intronic
1118960001 14:70520678-70520700 TCCATTCTGCAGCCCATGGATGG + Intergenic
1120755244 14:88237570-88237592 TCCATTCTTCAGCCCATGGATGG - Intronic
1120879876 14:89407154-89407176 TCCATTTGACAGGAAATAGAAGG + Intronic
1125827750 15:42690579-42690601 TCCATTTCATAGGCCCTGGAAGG - Exonic
1126476005 15:49065817-49065839 TCAATTCTACAGGTCAGGGACGG + Intergenic
1126959654 15:53977437-53977459 GGCATTTTTCAGTACATGGAGGG - Intergenic
1127816009 15:62609397-62609419 TTCATTATAAAGGACATGGCTGG - Intronic
1130971183 15:88734217-88734239 TGCTTTTCAGAGGACATGGATGG + Intergenic
1133143161 16:3763120-3763142 TTCATCTTACAGCACATAGAAGG - Intronic
1135515459 16:23128849-23128871 ACCATTTTACAGGAAATACATGG + Intronic
1137030348 16:35518168-35518190 TCCTTTTTACATGGCATGCAAGG + Intergenic
1137702510 16:50507103-50507125 TCCCTTTCAGAGGACATGGTTGG + Intergenic
1138044767 16:53710092-53710114 ACCAATTTAAAGGACATGAAAGG - Intronic
1139275542 16:65724229-65724251 TTCATTCAACAGGACTTGGAGGG - Intergenic
1139730192 16:68937227-68937249 TCCCTTTTCCAGGACATAAATGG - Intronic
1143638762 17:8182968-8182990 ACCAGTTTACAGGACATGCAGGG - Intergenic
1145845186 17:28032461-28032483 TCCATTTTTCAGTCCCTGGATGG - Intergenic
1149170693 17:53807867-53807889 TCCAGTGTACATGAAATGGATGG + Intergenic
1150669798 17:67182901-67182923 TACCTTTAACAGGACCTGGAAGG + Intronic
1151900184 17:77007302-77007324 TCCATTTTACCAGAGATTGATGG + Intergenic
1152488463 17:80611952-80611974 TCCAGTTTGCAGGAAATGCAGGG - Intronic
1152489753 17:80622225-80622247 TCCATATTACAGGGCATGAAAGG + Intronic
1153380615 18:4435016-4435038 TTCATCTGACAGGTCATGGAGGG + Intronic
1154226830 18:12512700-12512722 TCCATTTTACTGAGGATGGACGG + Intronic
1155498781 18:26466833-26466855 TCCAGTTTACAGGAAATTAAGGG + Intronic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1156782021 18:40861760-40861782 TCTATTTTACAGTTCATGGAAGG - Intergenic
1161930598 19:7336980-7337002 TCCCTTTAACTGGGCATGGAAGG - Intergenic
1163901210 19:20101588-20101610 TCTATTTTAAAGGACATAAATGG + Intronic
1167563105 19:50238313-50238335 GCCATTTTAAAGGCCATTGATGG + Intronic
928764122 2:34621550-34621572 TAGATGTTACAGGACTTGGAGGG + Intergenic
930413304 2:51054857-51054879 TCCAATTTATATGAGATGGAGGG - Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
933004236 2:76970142-76970164 ACCATTTTACATATCATGGAAGG - Intronic
935622287 2:105140860-105140882 TCCATATTACAAGAGAGGGAAGG + Intergenic
936925851 2:117736058-117736080 TACATCTAAAAGGACATGGAGGG - Intergenic
938565631 2:132515945-132515967 TAAATTTTACATGACATGGGAGG - Intronic
939043320 2:137219168-137219190 TCAATTTTGCAGAACATGGCAGG - Intronic
939076862 2:137613279-137613301 TCCAATTTACAGGAAATTCAAGG - Intronic
939721055 2:145651977-145651999 TTCATTCTACATGACATTGAAGG + Intergenic
940141426 2:150495446-150495468 TCCATTTTAATTAACATGGAAGG + Intronic
940154358 2:150638240-150638262 TTCATCTTGCAGCACATGGAAGG + Intergenic
940791664 2:158035550-158035572 TCCATTTTACAGAATCTTGATGG + Intronic
943587010 2:189752671-189752693 GGCATTTTACATGACATAGAAGG - Exonic
945552101 2:211233052-211233074 TCCATTTTTCAGGGTAGGGATGG + Intergenic
945628539 2:212240853-212240875 TCCGTCTTGCAAGACATGGAAGG - Intronic
945888022 2:215397720-215397742 TCCATCTCTCAGGACTTGGATGG + Exonic
947742571 2:232491317-232491339 TCCATTTCCCAGAACATGGCTGG + Intergenic
1169083586 20:2813743-2813765 TCCATATTGCAGGGCATGGGGGG - Intergenic
1170116812 20:12869280-12869302 GCCATGATGCAGGACATGGAAGG + Intergenic
1173125815 20:40335103-40335125 TCCACTTTAGATGAAATGGAAGG + Intergenic
1173679937 20:44871467-44871489 ACCAGTTTACAGGACATTGGAGG + Intergenic
1173894971 20:46543916-46543938 TGCATTTTACAGGCCAGGCATGG + Intronic
1179219586 21:39394622-39394644 CCCATTTTCCAGTTCATGGATGG + Intronic
1179611161 21:42551969-42551991 TCCAGTTTACAGGAGATACAGGG - Intronic
1182705546 22:32276689-32276711 TCCATTTTGGATGACCTGGAGGG - Intergenic
952580166 3:34824138-34824160 TCCCTTTTAAATGATATGGAAGG + Intergenic
953273094 3:41465661-41465683 ACCAATTTACAGGACATGTAGGG - Intronic
955358788 3:58254587-58254609 TCCATTTCCCAGGAAATGTAAGG + Intronic
956597799 3:70987342-70987364 TCCCTTTTACTGGACCTTGAAGG - Intronic
957225272 3:77435313-77435335 TCCTTTTTGCAGTACATTGATGG + Intronic
958787245 3:98611915-98611937 AAAATGTTACAGGACATGGATGG - Intergenic
959339820 3:105114663-105114685 GCCATTTGAAGGGACATGGATGG + Intergenic
959371069 3:105526628-105526650 TTCATTTTACTGGATTTGGAGGG - Intronic
959372370 3:105543709-105543731 ACAATTTTACAGGACAATGATGG - Intronic
959453986 3:106536262-106536284 TCCTGAATACAGGACATGGATGG - Intergenic
959867802 3:111291502-111291524 TAAATGTTACAGGATATGGATGG - Intergenic
962895688 3:139712460-139712482 ACCATTTAACCAGACATGGAAGG - Intergenic
963868180 3:150385446-150385468 CCCATTTTACAGTACAAGGAAGG + Intergenic
964867485 3:161277060-161277082 AAAATTTTACAGGATATGGATGG + Intergenic
965512149 3:169580068-169580090 TCCATTTTACAGGAAATAGCTGG + Intronic
971021749 4:22544054-22544076 TCCATTTGCCACAACATGGATGG + Intergenic
971399672 4:26264468-26264490 TCCATTTTAAAGAAAATGGAAGG - Intronic
972144982 4:36012584-36012606 TACATTTTGAAGAACATGGATGG - Intronic
973601447 4:52546769-52546791 TCGTTTTTACAGGACGTGGTGGG + Intergenic
973679809 4:53305099-53305121 TCCATTTGCCACAACATGGATGG - Intronic
974986806 4:69037463-69037485 TGTATTTTACAGGACATAGATGG - Intronic
975915816 4:79324567-79324589 ACCATTTTACAGAAAATAGAGGG - Intronic
976933380 4:90597942-90597964 GCCATTTGACACAACATGGATGG - Intronic
978855514 4:113389767-113389789 CCCATTTTCCAGTTCATGGATGG - Intergenic
980686268 4:136233857-136233879 TCCATAGCACAGGGCATGGAGGG - Intergenic
981833207 4:149025791-149025813 TGCCTAGTACAGGACATGGAAGG - Intergenic
982058691 4:151580284-151580306 TCCAATTTGCAGGAAATGCAGGG - Intronic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
983737811 4:171085678-171085700 TCCATTTTATATGACATGAAGGG + Intergenic
984609745 4:181824577-181824599 CCCATTTTATATGACATGAAGGG + Intergenic
985883108 5:2655757-2655779 TCCAATTTTCAGGACAAGGTGGG + Intergenic
986332029 5:6724405-6724427 TGCATTTCACAGGACATGCAAGG - Intronic
986571917 5:9174547-9174569 TGCATTCTGAAGGACATGGAAGG - Intronic
987923748 5:24314919-24314941 TCCATTTTACAGGAGCTGATTGG - Intergenic
989085725 5:37673918-37673940 TCCTTTTGCAAGGACATGGATGG - Intronic
991616533 5:68502660-68502682 TCAGTCTTATAGGACATGGATGG + Intergenic
993420198 5:87692013-87692035 TCCCTTTTTATGGACATGGATGG - Intergenic
993502525 5:88679273-88679295 ACCATTTCAGAGGACATGGTTGG - Intergenic
993529066 5:89003229-89003251 TCCATTTTGCAGAGGATGGATGG + Intergenic
994868522 5:105313047-105313069 TTCATTCTACATGACATGGATGG + Intergenic
995948997 5:117686810-117686832 TCCATTTTACAGGTCCAGTATGG + Intergenic
999457303 5:151728115-151728137 ACCATTTTACAGGAACTTGAGGG + Intergenic
999619998 5:153463244-153463266 TCCATTTTTCTGGAAATGGAGGG + Intergenic
1002630113 5:180568011-180568033 TCAATTTTACAGGAAGTGAAGGG - Intronic
1003547959 6:7076579-7076601 TCCATTTTACTGAAAAAGGAAGG + Intergenic
1006804878 6:36781637-36781659 TCCCTGTCCCAGGACATGGATGG - Intronic
1007806578 6:44454560-44454582 TCCATGTTACAGCACATGGCAGG - Intergenic
1007826811 6:44607015-44607037 ACAATTTTACAGGGCAAGGAGGG - Intergenic
1008255899 6:49299019-49299041 TCCATTTTCCAGAACAAGCATGG - Intergenic
1008979160 6:57463596-57463618 ACCATTTTTTAGGAGATGGAGGG + Intronic
1011355466 6:86468901-86468923 TCTTTATTATAGGACATGGAAGG - Intergenic
1011958191 6:93051193-93051215 TTCATTTTAAAGGACTTGCAGGG + Intergenic
1018865243 6:167742136-167742158 TCCATTTTAGAGAACATGGTGGG - Intergenic
1020077132 7:5265479-5265501 GCCATTTTACAAGAAATGGGAGG + Intergenic
1021551798 7:21878903-21878925 CCCATTTTAAAGGACAAGGCAGG + Intronic
1022588638 7:31640196-31640218 CCTATTTCACAGGACATTGAGGG - Intronic
1025201978 7:56968168-56968190 GCCATTTTACAAGAAATGGGAGG - Intergenic
1025284666 7:57651914-57651936 TCGATTTTCCTGGACATTGATGG - Intergenic
1025669969 7:63608760-63608782 GCCATTTTACAAGAAATGGGAGG + Intergenic
1027523470 7:79238174-79238196 TCAATTTTAAAGGAAATGAAAGG - Intronic
1029435474 7:100561870-100561892 TCCATTTATCAGAACATGGCAGG - Intronic
1038048397 8:23786700-23786722 TCCATTTTAGAAGACATGGTGGG - Intergenic
1039460805 8:37742494-37742516 TCCTTTGCACGGGACATGGATGG + Intronic
1039980911 8:42409354-42409376 TCCATCTCACTGGCCATGGAGGG - Intergenic
1041070542 8:54123921-54123943 TCTGTTTTCCAGGACATGGTAGG + Intergenic
1041320740 8:56610034-56610056 TCCATCTTTCAGGACAATGATGG + Intergenic
1041354898 8:56990135-56990157 TCCATCTTATAGGTCAAGGAAGG + Intronic
1041897262 8:62938998-62939020 TCAATGTTACTGGATATGGATGG + Intronic
1043513083 8:80969138-80969160 GCCATCTTCCAGGACATGGGCGG + Exonic
1044029815 8:87222545-87222567 TCAATTTTATAGGGCAAGGAGGG + Intronic
1044145077 8:88702948-88702970 GCCATTTTCCACAACATGGATGG - Intergenic
1047142269 8:122154498-122154520 TACATTTTAGAAGACATGTAAGG - Intergenic
1047313433 8:123711313-123711335 TCCCTTGAACAGGACAGGGAGGG - Intronic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048751013 8:137675713-137675735 TCCATTTGAGATGACATGCAGGG + Intergenic
1049017309 8:139929908-139929930 TCCATTTTACAGGACATGGAAGG - Intronic
1051297473 9:15611696-15611718 TCCTTTTACCAGGATATGGAGGG + Intronic
1051358993 9:16265385-16265407 TCCCTTTTTAGGGACATGGAGGG - Intronic
1051488957 9:17639160-17639182 TTTATTTTAAAAGACATGGAAGG + Intronic
1054793874 9:69280607-69280629 TCCATCTTCCAGGAGAAGGAAGG + Intergenic
1055024922 9:71709380-71709402 TCCATATTCCATGACATTGATGG - Exonic
1055811772 9:80157148-80157170 GCCATTTTACAGAGCTTGGATGG + Intergenic
1056396238 9:86183922-86183944 TTCATTTTCCAGGAAAGGGATGG - Intergenic
1057549860 9:96044472-96044494 TCCATTTTACAGTACAAGGCAGG - Intergenic
1061295581 9:129675153-129675175 TCCAGTATACAGGAGAGGGAGGG + Intronic
1188278781 X:28237174-28237196 TCCATTCTGCAGCCCATGGATGG - Intergenic
1188407467 X:29829255-29829277 TTTATGTTACATGACATGGAAGG + Intronic
1190754117 X:53386145-53386167 TCCAATTTACAGGAGATACAAGG + Intronic
1192571645 X:72211097-72211119 TCCATTTTTCAGGGCTTGGAGGG + Intronic
1194523345 X:94944824-94944846 TCCCAAATACAGGACATGGATGG - Intergenic
1198699257 X:139380261-139380283 TCCATTTGCCACAACATGGATGG - Intergenic
1199034704 X:143036061-143036083 GGCATTTTCCAGAACATGGATGG - Intergenic