ID: 1049017941

View in Genome Browser
Species Human (GRCh38)
Location 8:139934658-139934680
Sequence CTGTGGCCACATGTGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049017941_1049017947 2 Left 1049017941 8:139934658-139934680 CCAGGCTGCACATGTGGCCACAG 0: 1
1: 0
2: 2
3: 23
4: 308
Right 1049017947 8:139934683-139934705 GGCCCCATCCCTGCAGACTGGGG No data
1049017941_1049017951 6 Left 1049017941 8:139934658-139934680 CCAGGCTGCACATGTGGCCACAG 0: 1
1: 0
2: 2
3: 23
4: 308
Right 1049017951 8:139934687-139934709 CCATCCCTGCAGACTGGGGAAGG No data
1049017941_1049017946 1 Left 1049017941 8:139934658-139934680 CCAGGCTGCACATGTGGCCACAG 0: 1
1: 0
2: 2
3: 23
4: 308
Right 1049017946 8:139934682-139934704 AGGCCCCATCCCTGCAGACTGGG No data
1049017941_1049017945 0 Left 1049017941 8:139934658-139934680 CCAGGCTGCACATGTGGCCACAG 0: 1
1: 0
2: 2
3: 23
4: 308
Right 1049017945 8:139934681-139934703 GAGGCCCCATCCCTGCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049017941 Original CRISPR CTGTGGCCACATGTGCAGCC TGG (reversed) Intronic
900091052 1:920899-920921 CCGGGGCCACAGGTGCAGCCAGG - Intergenic
900625544 1:3606966-3606988 CTGGGGCCTGCTGTGCAGCCTGG + Intronic
900763487 1:4488361-4488383 CTGTGGCCACATGCCCGGCTAGG + Intergenic
901041079 1:6363937-6363959 CTGGGACCACAGGTGCAGCTGGG - Intronic
901058490 1:6460711-6460733 CGGGGGCCACAAGTGCGGCCCGG - Exonic
901215987 1:7555665-7555687 CTCTGGTCACATTTGCAGCCTGG + Intronic
901689609 1:10964127-10964149 CTGTGGGCCCATGTTCATCCAGG - Exonic
902445593 1:16461769-16461791 CTGTGGCCACACGTCTAACCAGG - Intergenic
903295973 1:22343220-22343242 CTGTGGCCACCTGGCCAGCAGGG - Intergenic
903968258 1:27102853-27102875 CTGTGGTTCCATGAGCAGCCAGG + Intronic
904597897 1:31658278-31658300 CAGTGACCTCATGTGCAGCCTGG + Intronic
904774333 1:32897372-32897394 CTGTGGCCACTTGTGCTGACCGG + Intronic
905465266 1:38148409-38148431 ATGAGGCCACTGGTGCAGCCTGG - Intergenic
906025958 1:42674055-42674077 CTGTAGCCTCATATGCAGCATGG - Intronic
906184334 1:43850261-43850283 CTGTGGCACCAGGTGCATCCAGG + Intronic
907459578 1:54597394-54597416 ATGTGGCCACCATTGCAGCCAGG + Exonic
907512023 1:54968864-54968886 CTCTGTCCACATGTGGAGTCAGG + Intergenic
911964815 1:104353019-104353041 CTGTGGCCAAATGTTGAACCTGG + Intergenic
916600486 1:166288597-166288619 CAGTGGGCCCATGTGCTGCCTGG + Intergenic
916783696 1:168065640-168065662 CTGTGGCCACATTTTCATCTGGG + Exonic
917670745 1:177270996-177271018 CTGTGTCCACATGTGGAGGGAGG + Intronic
922728716 1:227939184-227939206 CTGCGGCCCCATCTGCAGCGTGG - Intronic
922755337 1:228093454-228093476 CTCTGCCCATATGTGCAGCAGGG + Intronic
922856996 1:228783881-228783903 CTGAGGCCACATGTGGAGCCTGG - Intergenic
923144606 1:231189205-231189227 CTGTGGCCACATGTGAAATGAGG + Intronic
1062880686 10:975698-975720 CTGTCGCGTAATGTGCAGCCCGG + Intergenic
1063102580 10:2963318-2963340 GTGTGGCCAGGTGTGCGGCCAGG - Intergenic
1063106151 10:2993982-2994004 CTGGAGCCACACGCGCAGCCTGG + Intergenic
1063262558 10:4406742-4406764 CTGTGTCCACATTTTCTGCCTGG + Intergenic
1063476879 10:6336562-6336584 CTGAGACCACAGGTGCAGCCAGG + Intergenic
1064296072 10:14080149-14080171 TTGTGGCTTCATGTGCTGCCAGG - Intronic
1064641310 10:17418328-17418350 ATGTGCCACCATGTGCAGCCTGG + Intronic
1067124521 10:43504895-43504917 CTTTGGCAACATGTGAAACCCGG - Intergenic
1067233504 10:44427732-44427754 CTGGGGCCACATGTAGGGCCTGG + Intergenic
1067842764 10:49694767-49694789 CTGTGGGCTCCTGTGCAGCCAGG - Intronic
1071346657 10:84700080-84700102 CAGTGGGCAGATGTGCAGGCTGG + Intergenic
1072556067 10:96514253-96514275 CTCTGGCCACGTGTGCATCGGGG - Intergenic
1072692089 10:97578480-97578502 CTGCGTCCACATCTGCAGACTGG + Exonic
1073331837 10:102675060-102675082 CTAGAGCCACATTTGCAGCCTGG + Exonic
1075084006 10:119401985-119402007 GTGGGGCCACAGGAGCAGCCAGG - Intronic
1075860115 10:125667839-125667861 CAGTGGACTCATCTGCAGCCAGG + Intronic
1076737742 10:132466259-132466281 CTGTGGCCACAGGAGGGGCCCGG - Intergenic
1076814323 10:132907157-132907179 CTGTGGCCAAATGGCCAGCGTGG - Intronic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1077336083 11:2005223-2005245 CTGTGCCCACATCTGCCTCCAGG - Intergenic
1078665182 11:13318720-13318742 CTGTGGCCACATCTGGAGGGTGG + Intronic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1080643280 11:34170661-34170683 CAGTGGCCAGCTGTCCAGCCAGG + Intronic
1083688380 11:64391420-64391442 CAGTAGCCACCTGTGGAGCCTGG + Intergenic
1084089280 11:66869718-66869740 CTGTGGCCAGGTGTGCAGCGGGG - Intronic
1084690742 11:70724697-70724719 CTGTGTCGACACCTGCAGCCAGG + Intronic
1084940500 11:72610215-72610237 CTGTGGCCCCATGGACAGCCTGG + Intronic
1085032712 11:73282380-73282402 CAGAGGCCACGTGTGTAGCCTGG + Intronic
1085259397 11:75195695-75195717 CTTTGGCCTCCTCTGCAGCCTGG + Intronic
1085269156 11:75259975-75259997 CTGTGGCCCCAGCTCCAGCCTGG - Intergenic
1085402037 11:76241231-76241253 CTGGGCCCCCATGTGCAACCAGG + Intergenic
1085477636 11:76798015-76798037 CAGTGGCCACATGGGCATCAGGG + Exonic
1085572469 11:77571543-77571565 CTGTGACCCCAGGTGCCGCCGGG + Intronic
1088714746 11:112539105-112539127 GTTTGCCCACATCTGCAGCCTGG + Intergenic
1089625441 11:119748158-119748180 CTGTGGCCGGAAGTGCTGCCAGG - Intergenic
1091106011 11:132920566-132920588 CTGGGGCCATGTGTGCACCCTGG - Intronic
1202819067 11_KI270721v1_random:60405-60427 CTGTGCCCACATCTGCCTCCAGG - Intergenic
1091575200 12:1727561-1727583 CTGAAGCCACATGTGCTCCCTGG + Intronic
1091582781 12:1799172-1799194 CTGTGGCCACACGTGCAGGGCGG - Intronic
1091822558 12:3487214-3487236 CTGTGGCCATATGTGAACCCTGG + Intronic
1091951600 12:4597537-4597559 CTGTGGCCAAATGGACAGCTCGG + Intronic
1092737164 12:11593433-11593455 CTGAGGCCACAGGAGCAGGCAGG + Intergenic
1093942456 12:25069354-25069376 CTGGGGCCACTTGTGGGGCCTGG - Exonic
1097151289 12:56981707-56981729 CTGTGGGCTCATGGGCAGCTGGG - Intergenic
1100231989 12:92618129-92618151 CTGAGGCCATAGGTGCAGGCTGG - Intergenic
1100284529 12:93152647-93152669 CTGTGGAGACATGTGGGGCCAGG - Intergenic
1100734593 12:97512856-97512878 CCGTGGGCTCCTGTGCAGCCCGG - Intergenic
1101826848 12:108227082-108227104 CTGTGCCCAGAAGTGCAGCGCGG + Exonic
1102297383 12:111747626-111747648 CTGGGGTCACATGTGCAGGGAGG - Intronic
1103518306 12:121521475-121521497 CTCTGGACACATGTGCCACCTGG - Intronic
1103923893 12:124413265-124413287 CTGTGTCCACCTCTGCAGCGTGG + Intronic
1104076328 12:125392985-125393007 CTGTGCCCACATTTGCAACAAGG + Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105829325 13:24150055-24150077 TGGTGGCCAGGTGTGCAGCCTGG + Intronic
1106433885 13:29707365-29707387 CTGGGGCCACAGGTGAATCCAGG - Intergenic
1106453056 13:29901673-29901695 CTGAGGCCACATGTGAGCCCAGG - Intergenic
1106517512 13:30467882-30467904 CTGTGGCCATAAATGCACCCTGG - Intronic
1107389008 13:39943774-39943796 GTATGGCCACATGAGCATCCAGG - Intergenic
1108260862 13:48654719-48654741 TTCTGGCCAGATGTGCAGCCAGG - Intronic
1109562863 13:64075914-64075936 CGGTGGCCACAACAGCAGCCAGG + Intergenic
1109820862 13:67652054-67652076 CTCTGGCCACATGTGAAAGCAGG - Intergenic
1110548905 13:76789947-76789969 CTCTGGCCACATCTGCAGGAGGG - Intergenic
1114076277 14:19162882-19162904 CTGTGGCCAGAAGTGCACCTGGG + Intergenic
1114085887 14:19236687-19236709 CTGTGGCCAGAAGTGCACCTGGG - Intergenic
1114632014 14:24165110-24165132 GTGTGGCCATATGCCCAGCCTGG + Intronic
1115997801 14:39211896-39211918 CTGTGGCGACAGCTGCTGCCAGG + Intergenic
1117389320 14:55247988-55248010 CTATGGCCACAGGTACTGCCAGG - Intergenic
1118119014 14:62815350-62815372 AAGTGGACACATGTGTAGCCAGG - Intronic
1118324877 14:64773972-64773994 CTGTGCCCACATGGGCTGCGAGG - Intronic
1119647982 14:76362242-76362264 CTGTGGAAACATGGGCAGCGAGG + Intronic
1119669217 14:76506101-76506123 CTGAAGCCACAGGTGCTGCCTGG - Intergenic
1119735760 14:76980732-76980754 CTGTGGCCACCTGTGGAAACTGG + Intergenic
1121587023 14:95069391-95069413 CTGAAGCCACATCTCCAGCCTGG - Intergenic
1122106530 14:99461057-99461079 CTGTGGGCAGATAGGCAGCCTGG - Intronic
1122783703 14:104154423-104154445 CTGCGGCCACAGGTGGGGCCTGG + Intronic
1122972501 14:105158127-105158149 CAGGGGCCCCATGGGCAGCCGGG + Intronic
1123011331 14:105350923-105350945 CTGGGGCCTCACGTGCAGCGTGG - Intronic
1202897444 14_GL000194v1_random:18399-18421 CTGTGGCCAGAAGTGCACCTGGG - Intergenic
1124924615 15:34059239-34059261 CTTTGGACACATGTATAGCCTGG - Intronic
1127361528 15:58248597-58248619 CTGTGGCCACAAGAGGAGACAGG + Intronic
1128809679 15:70561801-70561823 CTGTGGTTATATGTGCTGCCAGG - Intergenic
1129987065 15:79927318-79927340 CTCTGGCAACATGTTCAGACTGG - Intergenic
1130224269 15:82045759-82045781 CTGCGGCCACAAAGGCAGCCGGG + Exonic
1130353820 15:83112480-83112502 CAGTGGCCATAGGTGCAGCAGGG + Intronic
1132573866 16:655992-656014 CCGTGGCACCCTGTGCAGCCAGG - Intronic
1132903835 16:2272149-2272171 CTCTGGCCAGTAGTGCAGCCGGG + Intergenic
1133309317 16:4833284-4833306 GTGTGGCCATTTGTGCTGCCTGG - Intronic
1134183366 16:12064760-12064782 CGGTGGCCACCTGGGCAGGCAGG - Intronic
1136409396 16:30067344-30067366 CAGTGGACTCATCTGCAGCCAGG - Exonic
1137571567 16:49569505-49569527 CTGAGGCCATATAGGCAGCCAGG - Intronic
1137607569 16:49796748-49796770 CTGGGGCCACTTGCTCAGCCTGG + Intronic
1137668383 16:50265341-50265363 CTGTGGCCTCTGGAGCAGCCTGG + Intronic
1139891139 16:70253890-70253912 CTCTGGCCACTGGTGCTGCCAGG + Intronic
1142239619 16:88939281-88939303 CTGTCACCACCTGTGAAGCCAGG - Intronic
1142472655 17:172004-172026 CTGTGGACCCCTCTGCAGCCTGG - Intronic
1143181304 17:4986156-4986178 CTGTGGCCACATTGGGAACCTGG + Intronic
1144495882 17:15744501-15744523 CAGTGGCCAGAGCTGCAGCCTGG - Intronic
1144586095 17:16488740-16488762 CTGTGGCCAGGGGTGCAGGCAGG - Intronic
1144632025 17:16878710-16878732 CAGTGGCCACAGCTGCAGCCTGG + Intergenic
1144769962 17:17754109-17754131 CACTGGCCAGCTGTGCAGCCTGG + Intronic
1145036218 17:19542443-19542465 CTGTGGCCACCTGGGCAAGCTGG + Exonic
1145209001 17:20999463-20999485 CAGTGGCCAGAGCTGCAGCCTGG - Intergenic
1145317299 17:21742638-21742660 CTGTGGCCACAGGCGTGGCCTGG - Intergenic
1145782201 17:27570742-27570764 CTGTGGCCACATCTGCCTTCTGG + Intronic
1146656322 17:34637272-34637294 CAGTGGCCACATGCTCATCCAGG - Exonic
1146686299 17:34843791-34843813 CAGGGGCCACATGGGAAGCCAGG + Intergenic
1146767166 17:35533936-35533958 CTGGGACTACAGGTGCAGCCTGG - Intronic
1146836830 17:36117795-36117817 CTGGGGACACTTGTGCTGCCAGG + Intergenic
1146841308 17:36157017-36157039 CTGTGGCCACATCTGTTCCCCGG + Intergenic
1146853559 17:36244654-36244676 CTGTGGCCACATCTGTTCCCCGG + Intronic
1146869468 17:36368546-36368568 CTGTGGCCACATCTGTTCCCCGG + Intronic
1147072343 17:37969170-37969192 CTGTGGCCACATCTGTTCCCCGG + Intergenic
1147083867 17:38048707-38048729 CTGTGGCCACATCTGTTCCCCGG + Intronic
1147099813 17:38172674-38172696 CTGTGGCCACATCTGTTCCCCGG + Intergenic
1148127084 17:45242479-45242501 CGGTGCCCACATGGGGAGCCAGG - Intronic
1150082820 17:62255964-62255986 CTGTGGCCACATCTGTTCCCCGG + Intergenic
1151235836 17:72719315-72719337 CCGTGGCCACATGTCCATACTGG + Intronic
1151254180 17:72862825-72862847 CTGAGGCCACATGTGCATGCGGG + Intronic
1151771622 17:76166383-76166405 CTGGGGCCACAGCTGCTGCCAGG + Intronic
1151904679 17:77039913-77039935 ATCAGGCCACATGAGCAGCCAGG - Intergenic
1153950794 18:10056186-10056208 CCGCGACCACGTGTGCAGCCTGG + Intergenic
1154047746 18:10922658-10922680 CTGGGGTCAGATGTGCAGCAGGG + Intronic
1154173184 18:12065611-12065633 CTGGGGCCAGATGTGCAGCAGGG - Intergenic
1155049105 18:22131084-22131106 CTGTGGGCTCAAGTGCAGCGTGG + Intergenic
1157222882 18:45839910-45839932 TTGTGGCCACAGCAGCAGCCAGG - Intronic
1160144179 18:76350357-76350379 CTGGGGCCACCTGTGGGGCCTGG - Intergenic
1160147834 18:76379057-76379079 CTCTGGCCACCTGTGCTGCGGGG - Exonic
1160822625 19:1065596-1065618 GTGTGGACATGTGTGCAGCCTGG - Intergenic
1160957651 19:1700753-1700775 CTGGGGCCAGAGGTGCAGACGGG + Intergenic
1161027694 19:2044234-2044256 CTGTGGCCACATGTGAGGTGGGG - Intronic
1161372507 19:3921058-3921080 CTGGGGCCTCATTTGCATCCTGG - Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1163007964 19:14408142-14408164 CTGTGGCCACAGGAGCTGCTGGG - Exonic
1163051927 19:14690591-14690613 CTGGGTCCACATGTGCAAACTGG + Intronic
1163605293 19:18271672-18271694 CTGTTCCCACATCTGCACCCTGG - Intronic
1163681904 19:18687605-18687627 GTTTGGCCACACCTGCAGCCAGG + Intronic
1164418557 19:28067181-28067203 CTGTGGCCCCAATGGCAGCCTGG + Intergenic
1164619710 19:29687349-29687371 CTGGGGCCAGAGGCGCAGCCAGG + Intergenic
1166157178 19:40922503-40922525 CTGTGCCCAGATGTGCACACAGG + Intergenic
1167463872 19:49640086-49640108 CGGTGGCGACATGAGCAGCGGGG - Exonic
1167621545 19:50563602-50563624 CTGGGGCCAAATGTGCAGCCTGG + Intronic
1168529732 19:57118333-57118355 CTGAGGCTCCATGAGCAGCCAGG + Intergenic
925171865 2:1754975-1754997 ATGTGGGCACATGGGCAGCGTGG - Intergenic
925233445 2:2256148-2256170 CTGTGCTCACATCTACAGCCCGG - Intronic
928469453 2:31559188-31559210 AAGTGGCAACATTTGCAGCCTGG - Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
929561185 2:42957581-42957603 CTGTGGCCATCTGGGGAGCCAGG - Intergenic
931848097 2:66225348-66225370 CTGATGCCACATTTGAAGCCAGG + Intergenic
932667377 2:73708301-73708323 CAGGGGGCACATGTGGAGCCTGG - Intergenic
932693868 2:73937270-73937292 GTGTGGCCACATGGGCAGTCCGG - Intronic
933659636 2:84916638-84916660 TTGTAGCCACATCTGAAGCCTGG - Intergenic
934854186 2:97718714-97718736 ACGTGGCCGCAGGTGCAGCCTGG - Intronic
937749421 2:125456741-125456763 CTGTGACCATAGCTGCAGCCTGG - Intergenic
938939133 2:136153798-136153820 CTGTGGCCAGATTGGCAGGCAGG - Intergenic
939115923 2:138060376-138060398 CTGTGGGCACATGGCCAGGCAGG - Intergenic
939755308 2:146102437-146102459 ATGAGGCCACAGGTGCAGGCTGG - Intergenic
941806685 2:169717121-169717143 CTGTGGCCACATAGCCAACCCGG + Intronic
945398020 2:209345743-209345765 CTATGGCCACATGAGTGGCCTGG + Intergenic
946815115 2:223569128-223569150 CTGTATTCACATGTGGAGCCTGG - Intergenic
947714697 2:232333658-232333680 CTGGGGCCCCTTGTGCAGCAAGG + Intronic
948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG + Intergenic
948427369 2:237896325-237896347 CCCTGGCTCCATGTGCAGCCAGG - Intronic
948904783 2:240973640-240973662 CTGTGGGCATATGTGGACCCCGG - Intronic
1168795014 20:605576-605598 CTGTGGTCCCATTTCCAGCCTGG + Intronic
1168994901 20:2125801-2125823 CAGGAGCCACATATGCAGCCAGG + Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1170603782 20:17860959-17860981 CTGTGACCCCTGGTGCAGCCTGG - Intergenic
1170628841 20:18050885-18050907 AGTTGGCCAAATGTGCAGCCAGG + Intronic
1170660158 20:18330652-18330674 CTCTGGGCATATGTCCAGCCTGG - Intergenic
1171215239 20:23347742-23347764 CAGTGGTCCCATGTGCAGCGTGG - Intergenic
1171330027 20:24329356-24329378 ATGAGGCCACAGGTGCAGGCTGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172512756 20:35511985-35512007 CTGTCTCCACTTGTGCAGCTGGG + Exonic
1172588459 20:36101304-36101326 CTCTCACCCCATGTGCAGCCCGG + Intronic
1172639953 20:36434903-36434925 CTGTGGTGACATGTGCAGTCTGG + Intronic
1172706603 20:36886805-36886827 CAATGGCCAGAAGTGCAGCCTGG - Intronic
1172749001 20:37236380-37236402 CTGTGGCCAAGTGTGTGGCCAGG - Intronic
1173870899 20:46341553-46341575 CTGTGCCCACATGTCCAGGTCGG + Intergenic
1174280538 20:49435774-49435796 CTGTGGCCAGATTTGCAGGCCGG - Intronic
1175258696 20:57662043-57662065 CTGGGGCCGCATCTGCACCCAGG + Intronic
1175258706 20:57662113-57662135 CTGGGGCCACGTCTGCACCCAGG + Intronic
1175424418 20:58854711-58854733 CTGGGGCGACATGGGCTGCCCGG - Exonic
1175515272 20:59566050-59566072 CACTGGGCACATGTGCAGGCTGG + Intergenic
1176094219 20:63332590-63332612 CTGAGACCACATTGGCAGCCAGG + Intronic
1176617129 21:9034388-9034410 CTGTGGCCAGAAGTGCACCTGGG - Intergenic
1176617690 21:9037147-9037169 CTGTGGCCTCATGTCCACCTTGG - Intergenic
1176707455 21:10126522-10126544 CTGTGGCCTCATGTCCACCTTGG + Intergenic
1178064069 21:28884681-28884703 CTGTAGCCACATGTGAGGACTGG + Intronic
1179016174 21:37595929-37595951 CTCTGGCTTCCTGTGCAGCCTGG + Intergenic
1179949896 21:44703656-44703678 CTGTGGCCCCAGGTCTAGCCGGG + Intronic
1180081905 21:45490957-45490979 CTGAGGTCACATGGGCAGCAGGG - Intronic
1180115986 21:45705357-45705379 CTGTGCCCACATCTCCAGTCTGG - Intronic
1180162644 21:46005247-46005269 CTCTGTCCACAGGTGCAGCATGG - Intergenic
1180292084 22:10856506-10856528 CTGTGGCCAGAAGTGCACCTGGG + Intergenic
1180494888 22:15885928-15885950 CTGTGGCCAGAAGTGCACCTGGG + Intergenic
1180751771 22:18129671-18129693 GTGTGGCAACATGGGTAGCCAGG - Intronic
1180835551 22:18927838-18927860 CAGTGGCCAGAGGGGCAGCCAGG + Intronic
1181280233 22:21714480-21714502 CTCTGTCCCCATGTGCAGCTGGG + Intronic
1182226118 22:28800256-28800278 CTGGGGCCAGATCTGAAGCCGGG - Intronic
1182522020 22:30890141-30890163 CTGTGTCCACATGTGTAGGGTGG + Intronic
1184798074 22:46743247-46743269 ATGGGGCCACATTTGGAGCCTGG + Intergenic
1185082182 22:48715588-48715610 TTGTGACCCCATGTGCTGCCTGG + Intronic
1185227185 22:49659806-49659828 CTGCGGCCACCTGTACATCCTGG - Intergenic
1185234709 22:49705162-49705184 CCTTGGCCACCTGTGCAGCATGG - Intergenic
1185406698 22:50656267-50656289 CTGAGGCCACATGGCCGGCCGGG + Intergenic
1203285639 22_KI270734v1_random:153137-153159 CAGTGGCCAGAGGGGCAGCCAGG + Intergenic
949706343 3:6822079-6822101 CTGAGGCCACATCTGCACCAGGG - Intronic
950013942 3:9743216-9743238 GTGTGGCCTCATCTCCAGCCAGG - Exonic
951267645 3:20588339-20588361 ATGTGGCCATATTTGCAGACAGG - Intergenic
951473008 3:23076607-23076629 CTGTAGCCACATGGACAGCTTGG + Intergenic
954108956 3:48423762-48423784 ACGTGGCCACAGCTGCAGCCTGG + Exonic
954154839 3:48679653-48679675 CTTTGGCGCCATGTGCAGCCTGG - Exonic
954655766 3:52193256-52193278 CAGTGGACTCATCTGCAGCCGGG - Intergenic
956065180 3:65390175-65390197 CAGTGACCACATTTGCAGCTAGG + Intronic
957182692 3:76900756-76900778 ATGTGACCACATCTGAAGCCTGG + Intronic
958106812 3:89084948-89084970 CTGTAGCCACATGGGAATCCTGG + Intergenic
960335094 3:116407782-116407804 CAGTGGCCACATGGGAAGCTGGG - Intronic
960939203 3:122922519-122922541 CTGTGGCCACCTGGGTTGCCAGG - Intronic
960974158 3:123159208-123159230 CTGAGGCCCCATGCCCAGCCCGG - Intronic
961445159 3:126977041-126977063 CTGTGTCCACATGTGTAGATGGG + Intergenic
961624166 3:128248043-128248065 CTGTGGCCGCCTGAGCAACCAGG - Intronic
962220892 3:133563921-133563943 CTGTGTCCCAATGTGCAGCAAGG + Intergenic
966763561 3:183438301-183438323 GTGAGGCCATAAGTGCAGCCTGG - Intergenic
967002701 3:185352076-185352098 ATGTGGTCACGTGTACAGCCAGG + Intronic
967043057 3:185711644-185711666 CTGTGGCCACCTGCTGAGCCAGG - Intronic
968524515 4:1049199-1049221 CTGTGGCCACAGGGGAGGCCGGG - Intergenic
968681328 4:1922561-1922583 CTGTGGCCACATTTGAAGAGAGG + Intronic
969656017 4:8499016-8499038 CTGTGGCTCCAGGTGCAGCAGGG + Intergenic
971018548 4:22512298-22512320 CTTTTGCTACATGTGCACCCTGG + Intronic
971971815 4:33630825-33630847 CTGTGTCCTCATCTGGAGCCTGG + Intergenic
975268125 4:72395210-72395232 CTTTTGCCATATGTGCAGCTGGG - Intronic
977317173 4:95465017-95465039 CTGGGGACACACGTTCAGCCTGG - Intronic
978498729 4:109386418-109386440 CTCTGGCAACATGGGCAGGCTGG - Intergenic
982133024 4:152247433-152247455 CCGAGGCCACCAGTGCAGCCAGG + Intergenic
984016337 4:174431490-174431512 CTGGGGCCACAGGTGCACACAGG - Intergenic
984202427 4:176742005-176742027 CAGGGGCCACATGTGCAGGTGGG + Intronic
984265700 4:177495881-177495903 CCGTGGGCTCCTGTGCAGCCCGG + Intergenic
985704332 5:1391858-1391880 CAGTGTCCCCATGTGCTGCCAGG + Intergenic
986010229 5:3707298-3707320 CTGTGGCAAAATGTGCAGTGCGG + Intergenic
986684430 5:10263730-10263752 CTGTAGCCACTTGTGTAGCTCGG + Intronic
986984006 5:13479908-13479930 CTGTGGCAACATATGTAGCTAGG - Intergenic
987967675 5:24896622-24896644 CTGAGGCCATAGGTGCAGACTGG - Intergenic
989373974 5:40740519-40740541 CCATGGCCACATATGCAGCAAGG + Intronic
992690347 5:79235864-79235886 CGGAGGCCACCTGTGCAGCAGGG + Intronic
994002062 5:94792160-94792182 CTGAGGACAGATGTGCAGCGTGG - Intronic
996442912 5:123512271-123512293 CTGTCGCCACCGATGCAGCCCGG - Intronic
997080192 5:130729248-130729270 CTGTGGTCACATGGACAGACTGG + Intergenic
997347605 5:133203243-133203265 TTGTGGCCACATGTGTAGAAAGG + Intronic
998166117 5:139845044-139845066 CTCTGGCCACATGTGTTCCCGGG + Intergenic
998503353 5:142652658-142652680 CTGGGCCCACACGTGCAGCCTGG + Intronic
1000611290 5:163378140-163378162 CTGTGGCCAGATGTGCCAGCAGG + Intergenic
1001167615 5:169384927-169384949 CTGTGGCCACAAGAACAGCCTGG + Intergenic
1001681612 5:173561964-173561986 CTGTGGCCACAGGTACTGCTGGG + Intergenic
1006140895 6:31928971-31928993 CTGGGGCCCAATGTGCATCCAGG + Intronic
1006497303 6:34433037-34433059 CTGTGGCCAGCACTGCAGCCAGG + Intergenic
1007483151 6:42163162-42163184 CTGTGGCTACCTGTACCGCCGGG + Exonic
1009615461 6:65999451-65999473 CCGTGGGCTCCTGTGCAGCCTGG - Intergenic
1011038860 6:83008272-83008294 CTGTGGCCTCATGTGTAGACTGG - Intronic
1011127698 6:84024356-84024378 CTGTGGCCTCAGGTGGAGGCAGG - Intergenic
1018096231 6:160389541-160389563 CTGTGCCCTGATGTGCAGCGTGG + Intronic
1018220726 6:161575972-161575994 CATGGGCCACATGTGCAGGCTGG + Intronic
1018239831 6:161762646-161762668 CGGTGGCCACATGTGAAGTTTGG + Intronic
1018475074 6:164132449-164132471 CTGTATGCACATGGGCAGCCAGG - Intergenic
1019733206 7:2638539-2638561 GTGTGGGGCCATGTGCAGCCTGG + Intronic
1019733265 7:2638781-2638803 CTGGGGCCACGTGTCCAGCTTGG + Intronic
1019939395 7:4277245-4277267 CTGTGGACACCTGGGCGGCCAGG - Intergenic
1022684346 7:32581876-32581898 CTGAAGCCACCTGGGCAGCCTGG - Intronic
1022864921 7:34407356-34407378 CTCTGCCCATATGAGCAGCCTGG - Intergenic
1023923098 7:44645259-44645281 CTGTGGCCACAGATGCATCCTGG + Intronic
1023996461 7:45161826-45161848 CAGTGCCCACACCTGCAGCCTGG - Intronic
1024660355 7:51487147-51487169 AGGTGGCCACATGGCCAGCCTGG + Intergenic
1032427855 7:131835952-131835974 ATGGGGCCACAAGTGGAGCCTGG - Intergenic
1032480391 7:132241335-132241357 AGGTGGCCACATATGCATCCAGG + Intronic
1033175907 7:139123546-139123568 CTGTGGCCACATCCTAAGCCAGG + Intergenic
1035234085 7:157485022-157485044 CTGAGTCCACACATGCAGCCAGG + Intergenic
1035353837 7:158265426-158265448 CTGTGGGCACACCTGCAGGCAGG + Intronic
1036577419 8:10041003-10041025 GAATGGGCACATGTGCAGCCAGG + Intergenic
1038454424 8:27663356-27663378 ATGAGGCCACAGGTGCAGGCTGG + Intronic
1040290987 8:46124471-46124493 CTGTGACCCCAGGTGCTGCCAGG + Intergenic
1046980952 8:120335860-120335882 CTGGGGCCATGTGTTCAGCCAGG + Intronic
1049017941 8:139934658-139934680 CTGTGGCCACATGTGCAGCCTGG - Intronic
1049176644 8:141196949-141196971 TTGTGGCCAGATGTGCAGCTAGG - Intergenic
1049443748 8:142620662-142620684 CTGTCTCCCCATGTGCACCCAGG - Intergenic
1049657250 8:143804348-143804370 CTGTGGCCATGTGGCCAGCCAGG + Intronic
1049671073 8:143870115-143870137 CTGTGGCCACTTGAGCCTCCAGG + Exonic
1051507100 9:17839329-17839351 CTGTGGTCAAATATGCAGCTTGG - Intergenic
1052881450 9:33603116-33603138 CTGGCCCCACATGGGCAGCCTGG - Intergenic
1053494868 9:38542729-38542751 CTGGCCCCACATGGGCAGCCTGG + Exonic
1054350106 9:64013136-64013158 CTGTGGCCTCATGTCCACCTTGG - Intergenic
1057219974 9:93252219-93252241 CTGTGCCCCCATGAGCAGGCAGG + Intronic
1058100749 9:100915568-100915590 CTCTGGCCTCATGTGCAACATGG + Intergenic
1059058963 9:111014923-111014945 ATGTGACCACATTTGGAGCCAGG + Intronic
1060655369 9:125368913-125368935 CAGTGGCCCAATCTGCAGCCTGG - Intergenic
1062040873 9:134403734-134403756 CTGTTGCTTCCTGTGCAGCCAGG + Intronic
1062494650 9:136826068-136826090 CGGTGGCGGCAGGTGCAGCCGGG + Intronic
1062627326 9:137449210-137449232 CTGCGGCCACGGGTGCAGCGAGG + Exonic
1062686457 9:137815924-137815946 CTGTGGACAGATGAGCAGCAAGG - Intronic
1202792203 9_KI270719v1_random:95402-95424 CTGTGGCCTCATGTCCACCTTGG + Intergenic
1186173094 X:6898169-6898191 CTGTGGACTCATGTGCTCCCTGG - Intergenic
1186682245 X:11887390-11887412 CTGGGGCTACATGTGGAGCGAGG - Intergenic
1186766546 X:12776282-12776304 CTATGGCTAGATGTGCAGGCAGG + Intergenic
1188756336 X:33968691-33968713 ATCTGGCCAAAGGTGCAGCCAGG + Intergenic
1188834683 X:34942689-34942711 CTGACGCCACCTGCGCAGCCCGG - Intergenic
1190721597 X:53153335-53153357 ATGAGGCCACAGGTGCAGACTGG + Intergenic
1192204686 X:69088208-69088230 CTGGGGCCAGAAGTCCAGCCTGG + Intergenic
1193077720 X:77373275-77373297 CTGTCGACACATGTACAGGCAGG + Intergenic
1197534741 X:127673751-127673773 CTGAGGCCATAGGTGCAGACTGG - Intergenic
1201150521 Y:11093221-11093243 CTGTGGCCAGAAGTGCACCTGGG - Intergenic
1201151078 Y:11095985-11096007 CTGTGGCCTCATGTCCACCTTGG - Intergenic