ID: 1049018644

View in Genome Browser
Species Human (GRCh38)
Location 8:139939237-139939259
Sequence GCAGAGGTGTTATCTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 235}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049018644_1049018652 5 Left 1049018644 8:139939237-139939259 CCTGGAAGAGATAACACCTCTGC 0: 1
1: 0
2: 1
3: 15
4: 235
Right 1049018652 8:139939265-139939287 ACCGGGGTCTGGAGAGGTCAAGG No data
1049018644_1049018656 21 Left 1049018644 8:139939237-139939259 CCTGGAAGAGATAACACCTCTGC 0: 1
1: 0
2: 1
3: 15
4: 235
Right 1049018656 8:139939281-139939303 GTCAAGGAGCATAGGAGCCAGGG No data
1049018644_1049018655 20 Left 1049018644 8:139939237-139939259 CCTGGAAGAGATAACACCTCTGC 0: 1
1: 0
2: 1
3: 15
4: 235
Right 1049018655 8:139939280-139939302 GGTCAAGGAGCATAGGAGCCAGG No data
1049018644_1049018657 29 Left 1049018644 8:139939237-139939259 CCTGGAAGAGATAACACCTCTGC 0: 1
1: 0
2: 1
3: 15
4: 235
Right 1049018657 8:139939289-139939311 GCATAGGAGCCAGGGCCCTGAGG No data
1049018644_1049018654 13 Left 1049018644 8:139939237-139939259 CCTGGAAGAGATAACACCTCTGC 0: 1
1: 0
2: 1
3: 15
4: 235
Right 1049018654 8:139939273-139939295 CTGGAGAGGTCAAGGAGCATAGG No data
1049018644_1049018651 -1 Left 1049018644 8:139939237-139939259 CCTGGAAGAGATAACACCTCTGC 0: 1
1: 0
2: 1
3: 15
4: 235
Right 1049018651 8:139939259-139939281 CTGGACACCGGGGTCTGGAGAGG No data
1049018644_1049018650 -6 Left 1049018644 8:139939237-139939259 CCTGGAAGAGATAACACCTCTGC 0: 1
1: 0
2: 1
3: 15
4: 235
Right 1049018650 8:139939254-139939276 CTCTGCTGGACACCGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049018644 Original CRISPR GCAGAGGTGTTATCTCTTCC AGG (reversed) Intronic
901046240 1:6397524-6397546 GCTGAGCTGTTATCTTTTCTGGG - Intergenic
901341382 1:8501280-8501302 GCAGAGGGGTCCTCACTTCCCGG - Intronic
901341500 1:8501563-8501585 GCAGAGGGGTCCTCACTTCCCGG - Intronic
902518789 1:17004381-17004403 GCTGCGGTATTACCTCTTCCAGG - Exonic
903026993 1:20436463-20436485 GCTGAGGTGTCACCTCCTCCAGG + Intergenic
904399612 1:30247592-30247614 GGAGACGCGTTGTCTCTTCCTGG - Intergenic
904911448 1:33937306-33937328 GCAGAGATGTCACCTCCTCCAGG - Intronic
905292111 1:36928905-36928927 GCACAGGTGCTATCTCCTCCAGG - Intronic
907650458 1:56289717-56289739 GCCCAGGTGTCACCTCTTCCAGG - Intergenic
907755308 1:57305178-57305200 GCAGAACTGTTACCTCTTCTAGG + Intronic
908865847 1:68547972-68547994 ACAGAGCTCTGATCTCTTCCTGG + Intergenic
912275859 1:108257821-108257843 GAAGTGGTGTGATCACTTCCTGG + Intergenic
912292369 1:108436535-108436557 GAAGTGGTGTGATCACTTCCTGG - Intronic
912415557 1:109506227-109506249 GCAGAGGTGGTATCTCTGAGAGG + Exonic
916802997 1:168231856-168231878 GAAGAGGTGTAGTCCCTTCCTGG - Exonic
917503874 1:175610837-175610859 GCAGTGGTGGCATCTCCTCCAGG - Intronic
918636144 1:186776709-186776731 GCAGAATTGATAACTCTTCCTGG - Intergenic
919160437 1:193823294-193823316 TCAGAGTTGCTATTTCTTCCTGG - Intergenic
919743434 1:200994074-200994096 GGGGAGGTGCTATGTCTTCCTGG + Intronic
919931537 1:202224453-202224475 GCCAAGGTGTCATGTCTTCCAGG + Intronic
920647871 1:207816493-207816515 GCAGAGCTATTAGCCCTTCCTGG + Intergenic
920893572 1:210019297-210019319 GCAGAGCTGTTAGCACTTTCTGG - Intronic
921116445 1:212096064-212096086 TCAGAGTTCTTATTTCTTCCTGG + Intronic
922869482 1:228890385-228890407 GCAGAGCTGTCATCTCTGCTTGG + Intergenic
922892309 1:229071543-229071565 GCAGAGGAGTTTACACTTCCTGG - Intergenic
923365958 1:233261684-233261706 GCAGAGGTGATATCCATTTCAGG + Intronic
924298576 1:242613824-242613846 GCAAAGGTGTTTTCACTTCTAGG + Intergenic
924846410 1:247777474-247777496 ACAGAGGTGCCATCTCTTCTGGG - Intergenic
1064601797 10:17001114-17001136 GCAGAGTTGTTCATTCTTCCCGG + Intronic
1064918926 10:20494236-20494258 GCAGTGGTGTTTTCTTCTCCTGG - Intergenic
1065894314 10:30149039-30149061 TCAGAGATTTTATATCTTCCTGG + Intergenic
1068420259 10:56781953-56781975 GCAGAAGTCTGATCTCTTCTGGG - Intergenic
1068428343 10:56897638-56897660 GCAGGGATGCTATCTGTTCCTGG + Intergenic
1069968539 10:72143909-72143931 TCAGAACTGTTATATCTTCCTGG + Intronic
1071444244 10:85731135-85731157 TCAGAGTTGTTGTCTCTTCCAGG - Intronic
1071514884 10:86290871-86290893 GAGGAGGTGTTCTCTCTTGCTGG - Intronic
1071671927 10:87616899-87616921 GCATAGGTGACATCTCTTCTAGG - Intergenic
1072201029 10:93158984-93159006 GCATTGGTGTTATTGCTTCCTGG + Intergenic
1073639883 10:105241209-105241231 GCAGTGGTGTTCCCTCTACCTGG + Intronic
1075581733 10:123623927-123623949 GCTGAGCTGTGATCTCTTTCCGG - Intergenic
1075718231 10:124569385-124569407 ACAGAGCTGCTGTCTCTTCCAGG + Intronic
1076471695 10:130723574-130723596 GCAAAGGTCTTATTTCTTCATGG + Intergenic
1076533597 10:131161523-131161545 GCACAGGTGTTATTCCTACCAGG - Intronic
1077236182 11:1483069-1483091 GCAGAGGTGTTTTCTCCACTGGG - Intronic
1081646259 11:44792702-44792724 ACTGAGGTGTCACCTCTTCCGGG - Intronic
1083496121 11:63055297-63055319 TCAGAAGTTTTATTTCTTCCTGG + Intergenic
1083782591 11:64925899-64925921 GCAGCGGTGTGAGCTCTTGCTGG - Exonic
1083846470 11:65337010-65337032 GCAGTGGTGTGATCTCTCCTGGG - Intronic
1084403460 11:68957953-68957975 ACATAAGTGTTATATCTTCCTGG - Intergenic
1084453487 11:69253816-69253838 CCAGAGGTGATTTCTCTTACTGG + Intergenic
1084903258 11:72326262-72326284 GCTCAGTTGTCATCTCTTCCAGG + Intronic
1085281542 11:75334245-75334267 GCAGTGGTGCTATCTCAGCCCGG - Intronic
1087690254 11:101312753-101312775 TCAGAGTTATTATATCTTCCTGG + Intergenic
1092453678 12:8625468-8625490 GCAGAGGGGTCCTCACTTCCCGG - Intergenic
1093243423 12:16706356-16706378 GCTCAGATGTTATCTTTTCCTGG + Intergenic
1093822212 12:23635247-23635269 CAAGTGGTGTTTTCTCTTCCTGG - Intronic
1098986042 12:77013450-77013472 GAAGACCTGTGATCTCTTCCTGG - Intergenic
1100369388 12:93953562-93953584 GCATAGGTTTTATCTGTTCTAGG - Intergenic
1100604644 12:96141718-96141740 CCGGAGCTGTTATCTCATCCAGG - Intergenic
1103615923 12:122152133-122152155 GCAGAGGTTTTGTCTTTTCCTGG + Intergenic
1105968614 13:25406784-25406806 GAAAATATGTTATCTCTTCCAGG + Intronic
1106285332 13:28313644-28313666 GGAGCAGAGTTATCTCTTCCCGG - Intronic
1107659554 13:42625036-42625058 GCTCAGCTGTTATCTCCTCCTGG - Intergenic
1108924143 13:55717256-55717278 TCAGAGTTTTTATTTCTTCCTGG + Intergenic
1110311213 13:74051539-74051561 GCAGAGGTGTCTTGTCTTCCTGG + Intronic
1110375738 13:74791797-74791819 TCAGAGGTTGTATATCTTCCTGG + Intergenic
1112061692 13:95746801-95746823 GAATAGGTGTAATCTCTTTCTGG + Intronic
1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG + Exonic
1114929002 14:27443884-27443906 GCAGTGGTGCAATCTCTTCTCGG + Intergenic
1116730515 14:48615366-48615388 CCAGAGTTGTTTTTTCTTCCTGG - Intergenic
1119263815 14:73252912-73252934 GGAGAGGTGGCAGCTCTTCCTGG + Intronic
1119538082 14:75419295-75419317 GCAGAGGTGTCTCCTCTTACAGG + Intergenic
1121031904 14:90665186-90665208 GCAGTGGTATTATTTCTACCAGG + Intronic
1122161329 14:99786314-99786336 GAAGATGTGTGTTCTCTTCCAGG + Intronic
1124955900 15:34360119-34360141 CCAGACGAGTTAGCTCTTCCAGG + Exonic
1126075484 15:44904870-44904892 GCACAGATCTCATCTCTTCCTGG - Intergenic
1126184392 15:45817212-45817234 TCAGAGATTTTATATCTTCCAGG + Intergenic
1126295508 15:47132868-47132890 GCAGAGGGGTCCTCACTTCCCGG - Intergenic
1127316777 15:57803152-57803174 GCAGAGGGGTTGCCTCTTGCTGG + Intergenic
1128781250 15:70360034-70360056 GCAGATGGGTTCTCTCTGCCCGG + Intergenic
1129168691 15:73794538-73794560 GCCAAGATTTTATCTCTTCCAGG - Intergenic
1129293188 15:74584361-74584383 ACACAGGTCTTAACTCTTCCAGG + Intronic
1130411166 15:83649875-83649897 CCAGATGTGTTATCTCTTAGTGG + Intergenic
1131025740 15:89140013-89140035 GCAGAGGTGTTACATCATCCTGG - Intronic
1133060986 16:3174498-3174520 GCTGAGGTCCTATTTCTTCCAGG - Intergenic
1136110398 16:28061107-28061129 GCAGAGGTGGTATCTCCCCAGGG + Intronic
1136992470 16:35162625-35162647 GCAGAGCTGATATCAATTCCTGG - Intergenic
1137000819 16:35229273-35229295 GCAGAGCTGATATCAATTCCTGG + Intergenic
1137549837 16:49429890-49429912 GCCCAGATGTCATCTCTTCCAGG + Intergenic
1138530683 16:57632742-57632764 GCTGAGCTTTTATCTCTGCCTGG - Intronic
1139190807 16:64860831-64860853 GCAGAGATGTGTTCTCCTCCAGG - Intergenic
1139530301 16:67539391-67539413 GCAGAAGTGTTCCCTCCTCCAGG - Intronic
1140745245 16:77975163-77975185 GCAGAGGTGCTTTCTCCTACTGG + Intronic
1144120852 17:12150958-12150980 ACAGAGCTCTGATCTCTTCCTGG + Intergenic
1145357562 17:22175619-22175641 GCAGTGGTGCTATCTCCGCCTGG + Intergenic
1147616656 17:41832815-41832837 GCAGTGGTGTGATCTCGTCTTGG - Intronic
1147911635 17:43859552-43859574 GCAGAAGTGTCACCTGTTCCAGG - Intronic
1152645742 17:81467807-81467829 GCCCAGGTGTTACTTCTTCCAGG - Intergenic
1153176041 18:2374462-2374484 TCAGAGCTGCTATTTCTTCCTGG + Intergenic
1154188752 18:12209766-12209788 GCAGTGGTGTGATCTCGTCTCGG + Intergenic
1154991897 18:21605408-21605430 GCAGAGGCTTTATCTATTGCAGG - Intergenic
1156216771 18:35007104-35007126 GCTTAGGTGGTTTCTCTTCCTGG - Intronic
1158440485 18:57470641-57470663 GCAGTGGTGTTAGCTCTTCAAGG - Intronic
1159078409 18:63707607-63707629 GCAGGGATATTATCTCCTCCAGG + Intronic
1164096650 19:22016175-22016197 TCAGAGCTTTTATTTCTTCCGGG + Intergenic
1164486515 19:28660587-28660609 CCAGAGGTGTTGTCTCTTATAGG - Intergenic
1168127138 19:54290841-54290863 TCAGATGTGCTTTCTCTTCCAGG + Intergenic
1168173221 19:54604669-54604691 TCAGATGTGCTTTCTCTTCCAGG - Intronic
927024820 2:19055954-19055976 TCAGAGATTTTATATCTTCCTGG + Intergenic
927177933 2:20423255-20423277 GCTCAGGTGTCATTTCTTCCAGG + Intergenic
928300846 2:30122464-30122486 CCAGAGGTTTCATCTCTACCAGG + Intergenic
929035301 2:37685414-37685436 GCAAAGGTGTTATTGCTTCTAGG - Intronic
929197371 2:39199286-39199308 TCAGAGGTTCTATTTCTTCCTGG - Intronic
929739652 2:44588548-44588570 GCAGAGGGGTCCTCACTTCCCGG - Intronic
930090585 2:47528613-47528635 GCAGAGGCGTGATCTGTCCCTGG + Intronic
930334270 2:50025825-50025847 GCACACTTGTGATCTCTTCCTGG - Intronic
932054034 2:68426629-68426651 CCAGAGGTCTCATCTCTTCCAGG + Intergenic
932358399 2:71085742-71085764 GCAGAGGTGCTCTGTCTACCGGG + Intergenic
932370638 2:71184627-71184649 GCAGAGGTGCTCTGTCTACCGGG + Exonic
933229127 2:79785498-79785520 GCAGAGGTGCTATTTCATACAGG - Intronic
934116315 2:88798875-88798897 GCATATGTGTTATCTATTTCTGG + Intergenic
934768258 2:96892630-96892652 GCAGAGGTGTGATTCCTGCCAGG - Intronic
935388258 2:102523848-102523870 GCTCATGTGTTTTCTCTTCCTGG + Intronic
937296961 2:120815300-120815322 GCTGAGGTGCTTTCTCTCCCCGG - Intronic
937448047 2:121975394-121975416 GCAGAGAAGCCATCTCTTCCTGG - Intergenic
937999185 2:127719297-127719319 GCAGAGGCGTTTTCTGTTGCTGG + Exonic
938874977 2:135522655-135522677 GCAGTGGTGTGATCTCGGCCTGG - Intronic
939219598 2:139284699-139284721 TCAGAGGTTCTATTTCTTCCTGG - Intergenic
939500411 2:142976414-142976436 GGAGAAGTGTTGTCTCTACCAGG + Intronic
945949387 2:216024392-216024414 GCAGTGGTGTGATCTATGCCTGG - Intronic
947607375 2:231496622-231496644 GCAGTGGTGTGATCTCGGCCAGG + Intergenic
947920411 2:233866511-233866533 GCACAGGTGTCTTCTTTTCCAGG + Intergenic
948136176 2:235638012-235638034 ATCGAGCTGTTATCTCTTCCAGG + Intronic
948256608 2:236573305-236573327 GAAGAGGTGTTATCTGCTCAAGG + Intronic
1169944905 20:10978270-10978292 AAAGGGGTGTTATCTGTTCCAGG - Intergenic
1171482541 20:25464939-25464961 GCAGAGATGCTATCTGTTCCTGG + Intronic
1171988288 20:31676014-31676036 GCGGAGGTGTTATCTCCTCCCGG - Intronic
1173133204 20:40414122-40414144 ACTCAGGTGTCATCTCTTCCTGG + Intergenic
1173949662 20:46980003-46980025 CCAGACGTGTTATCTGCTCCAGG - Intronic
1174595184 20:51678274-51678296 AAAGAGGTGTTTTCTCTTTCTGG - Intronic
1176303416 21:5110834-5110856 TCAGAGTTGCTATGTCTTCCTGG + Intergenic
1176305137 21:5119253-5119275 GCAGCTGTGTTATCTATTGCTGG - Intronic
1179851918 21:44142777-44142799 GCAGCTGTGTTATCTATTGCTGG + Intronic
1179853617 21:44151116-44151138 TCAGAGTTGCTATGTCTTCCTGG - Intergenic
1180186502 21:46142518-46142540 GCACAGCTGTTAGCTCCTCCCGG + Intronic
1182034792 22:27189372-27189394 GCTTAGGTGTCACCTCTTCCAGG - Intergenic
1182727869 22:32462305-32462327 GCAGACATGATATCTCTCCCTGG + Intronic
1182868446 22:33625386-33625408 CCAGAGGCATTATCACTTCCAGG + Intronic
1183042689 22:35194068-35194090 GAAAATGTGTTATCTCTTTCAGG - Intergenic
1184142647 22:42587183-42587205 GCAGTGGAGTTCTCTGTTCCCGG + Intronic
951129177 3:19021448-19021470 GTAATGGTGTTATATCTTCCTGG + Intergenic
952079413 3:29739856-29739878 GCAGAGGTGTTGGCTTTGCCAGG + Exonic
952714645 3:36467538-36467560 TCAGAGGTTTTATATTTTCCTGG + Intronic
953756946 3:45654755-45654777 GCAGTGGTGCAATCTCCTCCTGG - Intronic
953790162 3:45941264-45941286 GCAGAGCTGTTATCAGTTCCAGG - Intronic
955003166 3:54945818-54945840 GCAGAGAAGTTATTTCTGCCAGG + Intronic
955057133 3:55464928-55464950 GGAGAGGTGGCATCTATTCCAGG - Intergenic
955776988 3:62444132-62444154 GCAGAGGGGGTATCTCAGCCAGG - Intronic
955956346 3:64293681-64293703 GCACAGGTGTTGCTTCTTCCTGG + Intronic
956242962 3:67150252-67150274 GCAGAGGTGAGATCAATTCCTGG - Intergenic
961075333 3:123976887-123976909 GCTCAGGTGTTAGCTCTGCCCGG + Exonic
961514504 3:127424334-127424356 GCTGAGGTTTCGTCTCTTCCAGG - Intergenic
962627246 3:137238163-137238185 GCATACATGTTACCTCTTCCTGG - Intergenic
962649972 3:137478660-137478682 GCAGAGTTATTATCTTTTCTTGG - Intergenic
963806492 3:149728178-149728200 CCAGAGGTGCTATCCCGTCCTGG - Intronic
966860435 3:184228753-184228775 GCAGAGATGTTTTCTCTTCAGGG + Intronic
967578492 3:191125001-191125023 GCAGAGGGGCTCTCACTTCCCGG + Intergenic
967786210 3:193500020-193500042 GCAGAGATGTTTTCTCCTGCGGG - Intronic
967870655 3:194226151-194226173 GCTGAGGTGTGACCTCTTCTGGG + Intergenic
969404981 4:6985450-6985472 GCATAAGTTTTATCTCTTACTGG - Intronic
970811256 4:20096786-20096808 CCAGAGGAGTTAACTCTTTCTGG + Intergenic
972673645 4:41238204-41238226 GTAGAATTGTTATATCTTCCTGG + Intergenic
974297139 4:60015235-60015257 GCAGAGGTGTTTTACCTCCCTGG + Intergenic
974534128 4:63153007-63153029 CCAGAGTTGTTTTCTCCTCCTGG + Intergenic
975558328 4:75686435-75686457 GCTTAGGTGTCATCTCCTCCAGG - Intronic
977552152 4:98453494-98453516 TCAGAGTTTTTATTTCTTCCTGG + Intergenic
978964139 4:114721848-114721870 GCAGTGGTGTTTTCTTTACCTGG - Intergenic
979338641 4:119492987-119493009 GCATATGTGATTTCTCTTCCTGG - Intergenic
979621494 4:122803819-122803841 GCAGAATTGTTATCTCTCCTAGG + Intergenic
979856689 4:125641553-125641575 TCAGAGGCTTTATTTCTTCCAGG - Intergenic
980580113 4:134739454-134739476 TCAGAGTTTTTATTTCTTCCTGG - Intergenic
980844851 4:138312360-138312382 GCACAGGTGTTTTCTCTCACTGG - Intergenic
982448456 4:155523038-155523060 GTAGAGGTGTTATTTATTCCTGG - Intergenic
982804189 4:159742890-159742912 TCAGAGTTTTTATTTCTTCCTGG + Intergenic
983800166 4:171918509-171918531 GCAGAGGTTTTAAATATTCCGGG - Intronic
984918583 4:184744478-184744500 GGAGCGGTGTTACCTCTCCCTGG - Intergenic
987068492 5:14313127-14313149 CAAGAGGTGTTATCTCGCCCAGG + Intronic
987176438 5:15315473-15315495 TCAGAGTTTTTATATCTTCCTGG - Intergenic
988798237 5:34672681-34672703 GGTTAGGTGGTATCTCTTCCAGG + Intronic
989312794 5:40039962-40039984 TCAGAGCTGTTCTCCCTTCCTGG + Intergenic
991777250 5:70097213-70097235 GAGCAGGTGTTTTCTCTTCCCGG - Intergenic
991856536 5:70972656-70972678 GAGCAGGTGTTTTCTCTTCCCGG - Intronic
992472814 5:77075145-77075167 GCAGAGTTGTAATCTCCTCTGGG - Exonic
997186396 5:131885748-131885770 GCTGAGCTGTTATGTTTTCCTGG - Intronic
1004146839 6:13075687-13075709 ACAGAGGATTTATCCCTTCCAGG + Intronic
1004440120 6:15641988-15642010 GCAGCAGTGTTCTCTCTGCCAGG + Intronic
1006956751 6:37880523-37880545 TCAGAGGGGGTATCTCATCCTGG - Intronic
1007215549 6:40234777-40234799 GCAGAAGTGTTATACCTTGCTGG + Intergenic
1012352973 6:98276436-98276458 GCTCAGGTATCATCTCTTCCTGG + Intergenic
1014028055 6:116671637-116671659 TCAGGGGTGTGATCTCCTCCAGG + Intergenic
1014278339 6:119413428-119413450 TCAGAGTTTTTATTTCTTCCTGG + Intergenic
1015099608 6:129460773-129460795 GCCTAGGTTTTATCTCTTACAGG + Intronic
1016564030 6:145431961-145431983 TCTGAGATGGTATCTCTTCCTGG - Intergenic
1018648229 6:165967931-165967953 ACAGAGGTGTGATGTCTTACAGG - Intronic
1022202810 7:28134058-28134080 GCAGGGGTGTCATCTCTTGATGG + Intronic
1027199247 7:76052617-76052639 GCAGTGGTGTGATCTCCTCCTGG + Intronic
1029210703 7:98905884-98905906 TCAGAGGTGGGATCTCTGCCAGG + Intronic
1030332157 7:108282651-108282673 ACAGAGCTCTTATCTCTGCCAGG - Intronic
1031090190 7:117345367-117345389 TCAGAGTTTTTATTTCTTCCTGG + Intergenic
1032113093 7:129093192-129093214 GCAGTGGTGCAATCTCTACCTGG - Intergenic
1033323827 7:140362496-140362518 GCAGAGGGGTCCTCACTTCCCGG - Intronic
1035215537 7:157363777-157363799 GCAGAGGTGTTCTATGTTACTGG + Intronic
1035716226 8:1757142-1757164 GCGGAGGTGTGTCCTCTTCCAGG + Intronic
1038708233 8:29916521-29916543 TCAGGGGTTTTATTTCTTCCTGG - Intergenic
1039182920 8:34886648-34886670 GCTGAGGTCATATCCCTTCCAGG - Intergenic
1040433073 8:47363036-47363058 ACAGATGTGTTGTCTCTACCTGG + Intronic
1042440534 8:68820910-68820932 GCTGAGGCATCATCTCTTCCAGG - Intergenic
1042995789 8:74696765-74696787 TCAGAGTTTTTATTTCTTCCTGG - Intronic
1044912100 8:97071059-97071081 GCAGAGGAGTAAACTCTTCTTGG - Intronic
1045581318 8:103483383-103483405 ACAGAGATGTTTTCTCTTCCTGG - Intergenic
1045681889 8:104669792-104669814 GCCGAGGTGTTATTTCTGCCCGG + Intronic
1045823032 8:106363890-106363912 GCAGAAACGTTATTTCTTCCAGG - Intronic
1047215582 8:122873366-122873388 GCAGAAGTGTCATCTCCCCCGGG + Intronic
1048336628 8:133507474-133507496 GCAGAGGTGAAATACCTTCCTGG - Intronic
1048648900 8:136452954-136452976 TCAGAGGAGTTATCTGTCCCAGG + Intergenic
1049018644 8:139939237-139939259 GCAGAGGTGTTATCTCTTCCAGG - Intronic
1049492004 8:142910093-142910115 GCAGAGGTTCTAGTTCTTCCTGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1051160999 9:14207298-14207320 GCAGAGGTGCAACCTCTACCTGG - Intronic
1051395922 9:16620396-16620418 GCAAAAGTGTTATTTCTTCATGG + Intronic
1051410287 9:16782615-16782637 GCAGAGGTGTCACTTCCTCCAGG + Intronic
1052639592 9:31149705-31149727 GCACAGCTGGTATCTCTTCTTGG - Intergenic
1055408203 9:75997675-75997697 GCAGAGGTGTTATTTTTTGATGG + Intronic
1056103244 9:83320892-83320914 TCAGAAGTTTTATTTCTTCCTGG + Intronic
1057057253 9:91972872-91972894 GCAGAGCTCTGATCTCTCCCTGG + Intergenic
1062036819 9:134386157-134386179 GCAGAGCTGGAGTCTCTTCCAGG - Intronic
1185547926 X:960710-960732 GCTGGGGTATTTTCTCTTCCTGG + Intergenic
1185619149 X:1442801-1442823 GGGGCGGTGTTGTCTCTTCCTGG - Intronic
1185930285 X:4195399-4195421 GCAGAGGTGTCCTCTGCTCCAGG - Intergenic
1188901111 X:35733934-35733956 GCAGAGCTCTGATCTCTCCCTGG - Intergenic
1190729385 X:53215332-53215354 GCACAGGGGGAATCTCTTCCAGG + Intronic
1192018381 X:67357607-67357629 GGTGAGGTGTCATCTCATCCAGG + Intergenic
1192326368 X:70135552-70135574 GCACAGGAGTCACCTCTTCCAGG - Intronic
1193274559 X:79570557-79570579 GCAGAGTTTTTATTTCTCCCCGG - Intergenic
1193427959 X:81363515-81363537 GCAAAGGTATTACCTCTTCCAGG + Intergenic
1194076153 X:89396803-89396825 TCAGAGTTTTTATTTCTTCCTGG + Intergenic
1194470006 X:94282464-94282486 GCAGAGATTCTATATCTTCCTGG + Intergenic
1194505138 X:94724880-94724902 TCAGAGTTTTTATTTCTTCCTGG - Intergenic
1198674202 X:139114527-139114549 GCCCATGTGTTATCTCCTCCAGG - Intronic
1199564518 X:149200116-149200138 TCAGAGATTTTATTTCTTCCTGG + Intergenic
1200428792 Y:3052325-3052347 TCAGAGTTTTTATTTCTTCCTGG + Intergenic
1202602795 Y:26611161-26611183 CCAGAGCTGTTTTCTCCTCCTGG + Intergenic