ID: 1049020026

View in Genome Browser
Species Human (GRCh38)
Location 8:139950115-139950137
Sequence CCCCCACGGTCACCTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049020026_1049020034 7 Left 1049020026 8:139950115-139950137 CCAGCTTCAGGTGACCGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1049020034 8:139950145-139950167 GCGTGTGGCCACAGGAGCCCAGG No data
1049020026_1049020032 -8 Left 1049020026 8:139950115-139950137 CCAGCTTCAGGTGACCGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1049020032 8:139950130-139950152 CGTGGGGGAAGCGGGGCGTGTGG No data
1049020026_1049020033 -1 Left 1049020026 8:139950115-139950137 CCAGCTTCAGGTGACCGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1049020033 8:139950137-139950159 GAAGCGGGGCGTGTGGCCACAGG No data
1049020026_1049020036 19 Left 1049020026 8:139950115-139950137 CCAGCTTCAGGTGACCGTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1049020036 8:139950157-139950179 AGGAGCCCAGGATAGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049020026 Original CRISPR CCCCCACGGTCACCTGAAGC TGG (reversed) Intronic
901685616 1:10941915-10941937 CCCCCATGGTCATCTGGATCCGG + Intergenic
902835716 1:19045436-19045458 CCCCCAGTGTCCCCTGAGGCTGG + Intergenic
903215866 1:21842999-21843021 CCCCCAGGATCAACTGGAGCTGG - Intronic
903356310 1:22750039-22750061 CCCCCAAGGCCCCCTGAAGAAGG + Intronic
904901571 1:33861872-33861894 ACCCCAGGGTCACTTGGAGCTGG - Intronic
905850591 1:41271418-41271440 CCCCAGCAGTCACCTGAAGATGG - Intergenic
908070508 1:60454949-60454971 ACCCCGCTGTCACCAGAAGCAGG + Intergenic
921898778 1:220428562-220428584 GCCCCAAGGTGACCTGAGGCAGG - Intergenic
922912398 1:229228593-229228615 CCCCCTCAGTCTCCTGAAGCTGG - Intergenic
1064433283 10:15289687-15289709 TCCCCACTGTCACCTGTACCAGG + Intronic
1070829765 10:79411183-79411205 CCCCCAAGGGCACCTTGAGCAGG - Intronic
1071567710 10:86680289-86680311 TCCCCAGGGTCAGCTGCAGCAGG - Intronic
1076052911 10:127349451-127349473 CCCCCACCGCCACTTGATGCTGG - Intronic
1076103663 10:127803270-127803292 CCCCCAAGGTCACCTTGAGTGGG + Intergenic
1076696567 10:132250059-132250081 CCACCACAGTCACCAGGAGCCGG + Intronic
1077240473 11:1508015-1508037 ACCCCACGGCCCCCTGGAGCTGG + Intergenic
1077306318 11:1870215-1870237 CTCCCACGGCCCACTGAAGCTGG + Intronic
1077540274 11:3143302-3143324 CCCCCATGGGCCCCTGGAGCCGG - Intronic
1078437273 11:11335818-11335840 CCCTCAGGGCCACCAGAAGCTGG + Intronic
1081645198 11:44785522-44785544 CCCCCACCGCCCCCTGAAGCAGG + Intronic
1081988448 11:47324526-47324548 CTTCCAGGGTCACCTGCAGCAGG - Exonic
1083784037 11:64933760-64933782 CCCCCTGGGTCCCCTGTAGCCGG - Exonic
1090334256 11:125952051-125952073 CCCCCACTGCCACCTCCAGCTGG + Intergenic
1090925879 11:131250130-131250152 CACACAGGGTCACCTGGAGCCGG - Intergenic
1091220490 11:133927511-133927533 CCCCCAGGGACAGCTGAAGTAGG + Intronic
1092029129 12:5269216-5269238 CCCCCATGGACACCTGCAGCTGG + Intergenic
1092205831 12:6613792-6613814 CCCCCTCAGTCACATGCAGCCGG + Intergenic
1096403242 12:51324261-51324283 CCACCACTGTCAGCTGGAGCAGG + Intronic
1096876191 12:54632260-54632282 CAGCCAAGGTCACCTCAAGCAGG - Exonic
1097901575 12:64878725-64878747 CCCCCTTGGTCACATGAACCAGG + Intronic
1101920290 12:108927126-108927148 CCCCCAGGGTAACATGAAGAGGG - Intronic
1102051296 12:109864037-109864059 CCACCATGGTCAGCAGAAGCTGG + Intronic
1103317091 12:120064801-120064823 CCTCCACGGTCCCTTGGAGCAGG - Exonic
1104099358 12:125591714-125591736 CACCCAGGGCCACCAGAAGCTGG - Intronic
1104461415 12:128959394-128959416 CCCCCACTGCCTCATGAAGCTGG - Intronic
1104585454 12:130044889-130044911 CCCCCACCGCCACCTGACTCAGG + Intergenic
1105849726 13:24323223-24323245 CAACCACAGCCACCTGAAGCTGG + Intergenic
1110853921 13:80276757-80276779 CCCCCAGGAGCACCTGAATCTGG - Intergenic
1112276546 13:98026628-98026650 CCCCCATGCTCACATGAATCTGG + Intergenic
1113944479 13:114036179-114036201 CCCCCACTGGCATCTGACGCTGG + Intronic
1118443976 14:65835513-65835535 CCCCCAGGGGAACCTGACGCAGG - Intergenic
1118930391 14:70234939-70234961 CCCCCTGGCTCACCTGCAGCAGG - Intergenic
1121420409 14:93809130-93809152 ACCCCACCGTCAGCTGAGGCAGG - Intergenic
1122817482 14:104320771-104320793 CCCCCAAGGGTACCTGGAGCTGG + Intergenic
1122921052 14:104880304-104880326 CCTTCACGCTCACCTGCAGCTGG - Exonic
1129174840 15:73832558-73832580 CCCCCTCAGTCTCCTGAAGCAGG + Intergenic
1129606721 15:77028622-77028644 CGCCAACGGCCACCAGAAGCAGG + Exonic
1132573419 16:653886-653908 GACCCAGGGTCACATGAAGCTGG - Intronic
1132880610 16:2160236-2160258 CCCCCACCGTCCCCTCCAGCTGG - Intronic
1134612969 16:15625104-15625126 CCAGCAAGGTCACCTGAGGCTGG - Exonic
1136062900 16:27738831-27738853 ACCCCACGAGCACCTGAGGCAGG - Intronic
1141712443 16:85707942-85707964 CGCCCCCGGACACCTGAAGCCGG + Exonic
1142750827 17:1986606-1986628 CCCCCACGGCCCCCAGAAGCTGG + Intronic
1142890696 17:2940714-2940736 CCCCCATGTTCACCAGGAGCGGG - Intronic
1145309480 17:21693531-21693553 CCTGCACAGTCACCTGGAGCTGG - Intronic
1148496889 17:48058408-48058430 CCCCCAGGGACGCCTGATGCAGG - Exonic
1150618888 17:66793731-66793753 CCTCCACGCTCACCTGACGCTGG - Intronic
1151392305 17:73795582-73795604 CACCCAGGGCCACCAGAAGCTGG - Intergenic
1154461172 18:14588996-14589018 TCCTCACGGACACCAGAAGCTGG + Intergenic
1159007004 18:63022360-63022382 CGCCCTCCGTCACCTGGAGCAGG - Intergenic
1160985129 19:1835082-1835104 CCTGAAAGGTCACCTGAAGCTGG + Intronic
1166750775 19:45163125-45163147 GCCCCACCGTCTCCTGAGGCCGG + Exonic
1167439112 19:49498037-49498059 CCACTGCGCTCACCTGAAGCAGG - Exonic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1167751788 19:51385146-51385168 CCACCACGTCCATCTGAAGCCGG + Intronic
1167768457 19:51499592-51499614 CCCCCACGATCACCTGGATGGGG - Exonic
1167904612 19:52648692-52648714 CCACCACAGTCAGCTGAAACTGG + Intronic
1168004254 19:53473512-53473534 CCACCACAGTCAGCTGAAACTGG - Intronic
1168297465 19:55384356-55384378 CCCGCCTGGTCACCTGAACCGGG + Exonic
927916271 2:26938705-26938727 CCCCCACAGTCTCCTGGAGTGGG + Intronic
932460015 2:71876007-71876029 GCCACTCGGTCACCTGAGGCTGG + Intergenic
934736940 2:96694291-96694313 CCCTCACCCTCACCTCAAGCAGG - Intergenic
934939595 2:98490750-98490772 CTCCAACAGTCACCTGCAGCTGG + Intronic
935807953 2:106767454-106767476 CCTCCAGGGTCACCTCAGGCTGG + Intergenic
938566705 2:132525178-132525200 TCCCCACTGTCACCTTGAGCTGG + Intronic
940005145 2:149003343-149003365 CCACCACTGTCTCCTGCAGCGGG - Intronic
941125633 2:161580225-161580247 CCCCCAGTGTCCCCAGAAGCTGG - Intronic
941209826 2:162624153-162624175 GACCCAGGATCACCTGAAGCAGG + Intronic
948072274 2:235137641-235137663 CCCCCACTGTCATCTGCACCCGG + Intergenic
948836192 2:240627081-240627103 TCCCCACGGTCCCCGGCAGCGGG + Intronic
1170674793 20:18468884-18468906 CCCCCACTGTCTCTTGAAACAGG + Intronic
1171849521 20:30298073-30298095 CCCCCAGGGTCACCAAAACCTGG - Intergenic
1175217306 20:57398386-57398408 CCGCCACGGCGACCTGCAGCTGG - Intronic
1176170509 20:63694430-63694452 CCCCCAAGAGCACCTGAACCAGG + Exonic
1176813332 21:13568852-13568874 TCCTCACGGACACCAGAAGCTGG - Intergenic
1178371106 21:32028399-32028421 GCCCCAAGGGCACCTGAAGATGG - Intronic
1179646535 21:42779443-42779465 CCCTCACGTTCCCCTGCAGCAGG - Intergenic
1179724508 21:43334314-43334336 CCTCCTCAGTCTCCTGAAGCTGG + Intergenic
1182269046 22:29141957-29141979 TCCCTAAGGTCCCCTGAAGCAGG - Exonic
1184243213 22:43222420-43222442 CTCCCACGGTCCCCTGACCCTGG + Intronic
1184744160 22:46446356-46446378 CCCCCAGGGTCACCCTAAGCAGG - Intronic
1184781472 22:46651812-46651834 CCCTCAAAGGCACCTGAAGCAGG - Intronic
1184911073 22:47534724-47534746 CGCCCACGGGCAGCTGAAGCTGG - Intergenic
1185072112 22:48662121-48662143 GCCCCACGTCCACCTGGAGCTGG - Intronic
1185276752 22:49953235-49953257 CCCCCACGCTCACCTGGGACAGG + Intergenic
949922149 3:9011364-9011386 TCTCCACTGTCACCTGAATCAGG + Intronic
950857747 3:16121295-16121317 CCCCCAAGGTCCCCTGAATCCGG - Intergenic
950885368 3:16357852-16357874 GCCCCACGGTCAGATCAAGCAGG + Intronic
952898499 3:38094870-38094892 CCCCCACAGGCACGTGGAGCTGG + Exonic
955858846 3:63305219-63305241 CCCCCAGGCTCAGATGAAGCTGG - Intronic
958097071 3:88960058-88960080 TGCCCACGGGCACCAGAAGCTGG - Intergenic
961357657 3:126349283-126349305 CCCCCAAGGTCCCCTGGAGTGGG - Intronic
968818966 4:2836040-2836062 CTTACACGGTCACCTGGAGCCGG + Exonic
969054518 4:4393331-4393353 CCCACATGACCACCTGAAGCAGG + Intronic
969094246 4:4719988-4720010 CCCCCATTGCCTCCTGAAGCAGG + Intergenic
969609680 4:8219936-8219958 CGCCCACGGCCACCAGGAGCTGG - Intronic
969842366 4:9891926-9891948 TTCGCACTGTCACCTGAAGCTGG - Intronic
988854875 5:35218813-35218835 TCCCCACGGCCATCTGAGGCTGG - Intronic
996056449 5:118988281-118988303 GCCCCGCGGTCACCTGCAGCGGG + Exonic
1000635928 5:163643742-163643764 GCCCCACAGGCACCTGAATCTGG - Intergenic
1002858034 6:1055478-1055500 CCTGCACGGTCACCTGAGACTGG + Intergenic
1006129439 6:31860468-31860490 CCCCTACGGTCAGCCCAAGCAGG - Exonic
1006946624 6:37788648-37788670 CAGCCATGGCCACCTGAAGCAGG - Intergenic
1007617366 6:43188060-43188082 TCCCCTCAGTCACCAGAAGCTGG - Exonic
1009886438 6:69629068-69629090 TCTCCACTGACACCTGAAGCAGG - Intergenic
1018920369 6:168168195-168168217 CCCCCTGGGTCCCCTGAGGCTGG - Intergenic
1018962225 6:168457147-168457169 CTTCCACGGTCACCTGGAGATGG + Intronic
1020144788 7:5634187-5634209 CCCCCATGGTCACAGGAGGCTGG - Intronic
1022598994 7:31738780-31738802 CCACCTGTGTCACCTGAAGCGGG + Intergenic
1026739043 7:72967013-72967035 TCCCCAAGGTCACCAGAATCAGG + Intronic
1026790062 7:73325645-73325667 TCCCCAAGGTCACCAGAATCAGG + Intronic
1026837815 7:73649894-73649916 CCCACACGGCCCCTTGAAGCTGG - Intergenic
1027104690 7:75398060-75398082 TCCCCAAGGTCACCAGAATCAGG - Intronic
1028995293 7:97093310-97093332 CCCCCACACTCCCCTGAGGCAGG - Intergenic
1029449492 7:100633021-100633043 CCCCCACGCGCACCAGCAGCAGG + Exonic
1034275481 7:149822036-149822058 CCCCCACGGGCCCCAGGAGCAGG - Intergenic
1035472383 7:159118786-159118808 CTCCCACGGTCACTTGGCGCGGG + Intronic
1037440728 8:18913573-18913595 GCCCCAGGGTCTGCTGAAGCAGG - Intronic
1047232185 8:123007092-123007114 CACCCAGGGCCACCGGAAGCTGG - Intergenic
1047291125 8:123531424-123531446 CCCCCAGAGTCAGCTGAAGTAGG + Intronic
1049020026 8:139950115-139950137 CCCCCACGGTCACCTGAAGCTGG - Intronic
1049408954 8:142464037-142464059 CCCTCTCTGTCACCTGAAGCGGG + Exonic
1049558787 8:143297085-143297107 CTCCCACGGTCAGCTGCTGCGGG + Exonic
1049615824 8:143575510-143575532 CCCCCACGGCCACCAGCTGCAGG + Exonic
1051560801 9:18438421-18438443 CCCCCACGGACAGCTGAAGGCGG + Intergenic
1053269982 9:36743178-36743200 CCCGCACAGTCGCCTGATGCTGG + Intergenic
1053787302 9:41661367-41661389 CCCCCAGGGTCACCAAAACCTGG - Intergenic
1054157825 9:61653400-61653422 CCCCCAGGGTCACCAAAACCTGG + Intergenic
1054175580 9:61872706-61872728 CCCCCAGGGTCACCAAAACCTGG - Intergenic
1054477599 9:65584405-65584427 CCCCCAGGGTCACCAAAACCTGG + Intergenic
1054661959 9:67708104-67708126 CCCCCAGGGTCACCAAAACCTGG + Intergenic
1059322500 9:113480614-113480636 CCCACACGGTATCCTGAAGGAGG + Intronic
1061163504 9:128909612-128909634 CCCCCAAGGTGACCTTGAGCCGG + Intronic
1061275618 9:129568312-129568334 CCCCCACCGCCACCTCCAGCCGG + Intergenic
1062636320 9:137493503-137493525 CCCCAACCGTGCCCTGAAGCAGG - Intronic
1185456821 X:314906-314928 CCGCCAGGGCCACCTGAAGCCGG + Exonic
1188427723 X:30068112-30068134 ACCCCACAGCCACCTGTAGCAGG - Intergenic
1189253547 X:39620019-39620041 CCCACAAGGGCACCTCAAGCTGG + Intergenic
1190214604 X:48471230-48471252 CCTCCAGGGTCATCTGAACCTGG - Intergenic
1201963333 Y:19706515-19706537 CATCCAGGGTCACCTCAAGCAGG + Exonic
1202038418 Y:20658694-20658716 CCCCCATGGTTACCTAAAGAAGG + Intergenic