ID: 1049021059

View in Genome Browser
Species Human (GRCh38)
Location 8:139957950-139957972
Sequence CACCCACAGCCCCTGAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049021054_1049021059 -8 Left 1049021054 8:139957935-139957957 CCAACCTTCCAGCTCCACCCACA 0: 1
1: 0
2: 8
3: 70
4: 555
Right 1049021059 8:139957950-139957972 CACCCACAGCCCCTGAGGAGAGG No data
1049021053_1049021059 14 Left 1049021053 8:139957913-139957935 CCAAATGTATCAGAGGTTTCTGC 0: 1
1: 0
2: 0
3: 3
4: 140
Right 1049021059 8:139957950-139957972 CACCCACAGCCCCTGAGGAGAGG No data
1049021052_1049021059 15 Left 1049021052 8:139957912-139957934 CCCAAATGTATCAGAGGTTTCTG 0: 1
1: 0
2: 0
3: 16
4: 198
Right 1049021059 8:139957950-139957972 CACCCACAGCCCCTGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049021059 Original CRISPR CACCCACAGCCCCTGAGGAG AGG Intronic
No off target data available for this crispr