ID: 1049021561

View in Genome Browser
Species Human (GRCh38)
Location 8:139960796-139960818
Sequence TGCACTCCTGCCACTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049021556_1049021561 5 Left 1049021556 8:139960768-139960790 CCCCAAGTGACAGAGCTGCTGTC 0: 1
1: 0
2: 1
3: 21
4: 172
Right 1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG No data
1049021553_1049021561 23 Left 1049021553 8:139960750-139960772 CCTGGCCCTCAGGAAGAGCCCCA 0: 1
1: 0
2: 1
3: 34
4: 320
Right 1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG No data
1049021550_1049021561 28 Left 1049021550 8:139960745-139960767 CCCCACCTGGCCCTCAGGAAGAG 0: 1
1: 0
2: 3
3: 44
4: 376
Right 1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG No data
1049021555_1049021561 17 Left 1049021555 8:139960756-139960778 CCTCAGGAAGAGCCCCAAGTGAC 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG No data
1049021552_1049021561 26 Left 1049021552 8:139960747-139960769 CCACCTGGCCCTCAGGAAGAGCC 0: 1
1: 0
2: 1
3: 34
4: 324
Right 1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG No data
1049021557_1049021561 4 Left 1049021557 8:139960769-139960791 CCCAAGTGACAGAGCTGCTGTCC 0: 1
1: 0
2: 0
3: 35
4: 298
Right 1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG No data
1049021551_1049021561 27 Left 1049021551 8:139960746-139960768 CCCACCTGGCCCTCAGGAAGAGC 0: 1
1: 0
2: 1
3: 22
4: 498
Right 1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG No data
1049021558_1049021561 3 Left 1049021558 8:139960770-139960792 CCAAGTGACAGAGCTGCTGTCCC 0: 1
1: 0
2: 1
3: 35
4: 286
Right 1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG No data
1049021554_1049021561 18 Left 1049021554 8:139960755-139960777 CCCTCAGGAAGAGCCCCAAGTGA 0: 1
1: 0
2: 0
3: 19
4: 150
Right 1049021561 8:139960796-139960818 TGCACTCCTGCCACTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049021561 Original CRISPR TGCACTCCTGCCACTGCAGC TGG Intronic
No off target data available for this crispr