ID: 1049021900

View in Genome Browser
Species Human (GRCh38)
Location 8:139962845-139962867
Sequence AAACTTATGCAGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049021896_1049021900 -9 Left 1049021896 8:139962831-139962853 CCACAGAAGGAGGCAAACTTATG 0: 1
1: 0
2: 0
3: 6
4: 191
Right 1049021900 8:139962845-139962867 AAACTTATGCAGAGGCTGGAGGG No data
1049021890_1049021900 27 Left 1049021890 8:139962795-139962817 CCTTATAATGGAGAGAGGGAGGC 0: 1
1: 2
2: 11
3: 55
4: 238
Right 1049021900 8:139962845-139962867 AAACTTATGCAGAGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049021900 Original CRISPR AAACTTATGCAGAGGCTGGA GGG Intronic
No off target data available for this crispr