ID: 1049025914

View in Genome Browser
Species Human (GRCh38)
Location 8:139988738-139988760
Sequence GAGGCACTCATCCTGCACGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049025914_1049025919 12 Left 1049025914 8:139988738-139988760 CCGGCGTGCAGGATGAGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1049025919 8:139988773-139988795 GCTGACGGTCAGCTCATGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 76
1049025914_1049025917 -3 Left 1049025914 8:139988738-139988760 CCGGCGTGCAGGATGAGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1049025917 8:139988758-139988780 CTCGCTGCTCCTGGTGCTGACGG 0: 1
1: 0
2: 2
3: 16
4: 244
1049025914_1049025920 15 Left 1049025914 8:139988738-139988760 CCGGCGTGCAGGATGAGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1049025920 8:139988776-139988798 GACGGTCAGCTCATGCTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049025914 Original CRISPR GAGGCACTCATCCTGCACGC CGG (reversed) Exonic
901091768 1:6646348-6646370 GTGGTGCTCATACTGCACGCTGG + Intronic
901435539 1:9245307-9245329 GAGGCACAGCTCCAGCACGCAGG + Exonic
901465319 1:9417491-9417513 GAGGCACCACTCCTGCACACAGG - Intergenic
901842710 1:11964070-11964092 GTGCCCCTCAACCTGCACGCAGG - Intronic
907668984 1:56458134-56458156 GAGGCACACATCTTGTACGGAGG - Intergenic
907955820 1:59227367-59227389 GAGGCACTCATTCTGTTAGCTGG - Intergenic
922533220 1:226360437-226360459 GATGAACTCATCCTGCTCTCTGG - Intergenic
922540843 1:226418255-226418277 AAGGCAGGCATCCTGCAGGCAGG + Intergenic
923679417 1:236107495-236107517 GAAGCAGTCATCATGCAAGCTGG - Intergenic
1063979996 10:11445036-11445058 GAGGCACTCGCCCTGCCCGTGGG - Intergenic
1067066323 10:43106049-43106071 GAGGTGCTCATCCTGCTCTCTGG + Intronic
1069569328 10:69484917-69484939 GAGTCACTCTTCCTGCCCTCCGG + Intronic
1070799758 10:79238338-79238360 GGGCCACTCATCCTGGACCCAGG - Intronic
1076334263 10:129694427-129694449 GAGGCTGTCATGCTGCAGGCAGG - Intronic
1076874036 10:133207293-133207315 AAGGCCCGCATCCTGCAGGCCGG + Exonic
1077314278 11:1910206-1910228 GAGGGATGCACCCTGCACGCTGG + Intergenic
1077323906 11:1955256-1955278 AAGGCAATCCTCCTGCAGGCCGG + Intronic
1078549338 11:12269612-12269634 GAAGCCCTCATCCTGGACACTGG - Intergenic
1081614876 11:44584901-44584923 CAGGCACTCCACCTGCAAGCTGG - Intronic
1082095309 11:48125010-48125032 GAGGGACTCATCATGCACAGGGG - Exonic
1083147378 11:60769422-60769444 GAGGCAGTCAGCCGGCATGCGGG + Intronic
1083187824 11:61027649-61027671 GAGTCTCTCCTGCTGCACGCAGG - Intergenic
1085283295 11:75344650-75344672 GATGGACGCATCCTGCACACGGG + Intronic
1085327528 11:75618625-75618647 GAGGGACTCCCCCTGCACTCAGG - Intronic
1085350878 11:75797321-75797343 GAGGCACTCACCCATGACGCAGG - Exonic
1086155767 11:83664192-83664214 TAGGCTGTCATCCTGCAGGCTGG + Intronic
1202806892 11_KI270721v1_random:10451-10473 AAGGCAATCCTCCTGCAGGCCGG + Intergenic
1104566083 12:129885336-129885358 GAGGCAGTGATTCTGCACTCTGG - Intronic
1124137527 15:27048183-27048205 GAGGCACACAGCCTGCTCCCAGG - Intronic
1125484284 15:40101725-40101747 CAGGAACTCATCCTGCAGGAAGG - Intronic
1125710968 15:41785905-41785927 CAGACACTCATACTGCACGAAGG + Intronic
1131424723 15:92336192-92336214 AAGGCACTCTTCCTACACACTGG - Intergenic
1131430513 15:92384609-92384631 CGGGCACTCATCCTGCAGGGAGG + Intergenic
1132627751 16:899885-899907 GAGGCACACGCCCTGGACGCCGG + Intronic
1140565906 16:76042412-76042434 CAGGAACTCATCCTGCACTCAGG - Intergenic
1140804702 16:78522432-78522454 TAGTCACTCATCCTGCTCTCGGG + Intronic
1151604627 17:75128712-75128734 AAGGAGCACATCCTGCACGCAGG + Exonic
1157307934 18:46530514-46530536 GTGGCACTCATCCTGGACTAAGG + Intronic
1158238573 18:55349923-55349945 GAGACATTCTTCCTGCACTCTGG + Intronic
1160523758 18:79523705-79523727 GAGGCTCTCAGCCTGCAGCCAGG + Intronic
1160895842 19:1401466-1401488 GGGGCGCTCATGCTGCAGGCTGG + Exonic
1161269430 19:3381701-3381723 GTGGAACTCATCCTGCAGGCCGG - Exonic
1162792791 19:13071786-13071808 GGGGCCCTCATGCTGCAAGCAGG + Intronic
1167505168 19:49867416-49867438 GAGGCTCTCTGCCTGTACGCTGG - Intronic
1167888760 19:52523105-52523127 GAGTCGCGCATCCTGCAGGCGGG + Intergenic
1167898142 19:52598375-52598397 GAGTCACGCATCCGGCAGGCGGG + Intronic
928473463 2:31598351-31598373 GATGCACTCATCATCCAAGCAGG - Intergenic
928870000 2:35964702-35964724 GAGGAACTCATCTTGCAGTCAGG - Intergenic
931711630 2:64992835-64992857 GAGGAGCTCAGCCTCCACGCTGG - Intronic
937547913 2:123047280-123047302 GTGGCACTCATGCTGCAAACAGG + Intergenic
1169445684 20:5669354-5669376 GATGCACTCTTCCTGCCCTCAGG - Intergenic
1170904675 20:20502851-20502873 GAGGCAAACATCCTGCAGGTTGG + Intronic
1174492008 20:50906503-50906525 GAGCCACTCATCCAGGAGGCAGG - Intronic
1175752575 20:61509313-61509335 GAGGGACTCATCCTGCCCCAGGG + Intronic
1176164819 20:63667363-63667385 GGAGCCCTCATCCTGCACGTAGG - Intronic
1176298448 21:5086823-5086845 GGGGCACTCAGCCTTCACTCGGG - Intergenic
1177364032 21:20110658-20110680 GAGCCTCACATCCTGCAGGCAGG - Intergenic
1179858578 21:44175126-44175148 GGGGCACTCAGCCTTCACTCGGG + Intergenic
1180175154 21:46083717-46083739 GAGGCACTCACGCTGCCCTCTGG - Intergenic
1181521307 22:23450138-23450160 GAGGGACTCCTCCTCCAGGCTGG - Intergenic
1183723838 22:39577715-39577737 CAGGCCCTCAGCCGGCACGCTGG - Intronic
950082659 3:10234646-10234668 GAGGCTCACCTCCTGCAGGCTGG - Exonic
961714649 3:128850046-128850068 GAGGCACTCGACCTGCCCACGGG - Intergenic
969467360 4:7365688-7365710 CAGGCACAAAGCCTGCACGCCGG - Intronic
973832717 4:54778349-54778371 GAGGCACACAGGCTACACGCTGG - Intergenic
975234367 4:71974533-71974555 TAAGCACTCATCATGCACTCTGG + Intergenic
990968104 5:61471510-61471532 GAGGCACTCACCCTGCCCTGGGG - Intronic
992314279 5:75536609-75536631 GAGGCACCCACCCTGCCCCCTGG + Intronic
993629179 5:90263497-90263519 CAGGCTCTCATCTTGCACGGCGG - Intergenic
1013858235 6:114601961-114601983 GAGGCACCAGTCCTGCATGCTGG + Intergenic
1018382254 6:163269169-163269191 GAGGCACACATCCTCCTGGCTGG + Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1031739376 7:125409898-125409920 GAGGCATTTTTCCTTCACGCTGG + Intergenic
1032837342 7:135686411-135686433 GCTGCACTCATCCTGGACCCTGG - Intronic
1035370511 7:158376551-158376573 CTGTCACACATCCTGCACGCGGG + Intronic
1035370588 7:158376821-158376843 CTGTCACACATCCTGCACGCGGG + Intronic
1049025914 8:139988738-139988760 GAGGCACTCATCCTGCACGCCGG - Exonic
1049404229 8:142444494-142444516 GTGGCTCTCAGCCTGCACCCAGG - Intergenic
1053390257 9:37729836-37729858 GAGGAACTCATCCAGCAGGTAGG + Exonic
1058875598 9:109242136-109242158 GAGGCATTCATGGTGCATGCTGG - Intronic
1061816566 9:133200816-133200838 GAGGCACTCACCAGGCAAGCGGG + Intergenic
1062326635 9:136015518-136015540 GAGGCACTCGTCCTGCTGGGAGG + Intronic
1203759485 EBV:4698-4720 CAGGCACTCGTACTGCTCGCTGG - Intergenic
1185885355 X:3777503-3777525 GAGGCACTCAACATACAAGCAGG - Intergenic
1185931196 X:4205297-4205319 GAGGAACTCATCCTTCACCAGGG + Intergenic
1194888860 X:99353462-99353484 GAAGCACCCATCCTGCAAGGGGG + Intergenic
1197566776 X:128097924-128097946 TAGGCACTTATCATGCACTCTGG + Intergenic