ID: 1049030668

View in Genome Browser
Species Human (GRCh38)
Location 8:140035042-140035064
Sequence CTGTATACACAGCTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049030660_1049030668 24 Left 1049030660 8:140034995-140035017 CCTTGGTGCTAAATGCTGCATTC 0: 1
1: 0
2: 0
3: 14
4: 143
Right 1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG No data
1049030658_1049030668 30 Left 1049030658 8:140034989-140035011 CCCTGGCCTTGGTGCTAAATGCT 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG No data
1049030659_1049030668 29 Left 1049030659 8:140034990-140035012 CCTGGCCTTGGTGCTAAATGCTG 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049030668 Original CRISPR CTGTATACACAGCTGGAGGA GGG Intronic
No off target data available for this crispr