ID: 1049033774

View in Genome Browser
Species Human (GRCh38)
Location 8:140058626-140058648
Sequence CCTGCAAGACAGACAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049033765_1049033774 22 Left 1049033765 8:140058581-140058603 CCTCACAGACAAAGACAAGCTGG 0: 1
1: 0
2: 5
3: 33
4: 475
Right 1049033774 8:140058626-140058648 CCTGCAAGACAGACAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049033774 Original CRISPR CCTGCAAGACAGACAGTGGA AGG Intronic
No off target data available for this crispr