ID: 1049033774 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:140058626-140058648 |
Sequence | CCTGCAAGACAGACAGTGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049033765_1049033774 | 22 | Left | 1049033765 | 8:140058581-140058603 | CCTCACAGACAAAGACAAGCTGG | 0: 1 1: 0 2: 5 3: 33 4: 475 |
||
Right | 1049033774 | 8:140058626-140058648 | CCTGCAAGACAGACAGTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049033774 | Original CRISPR | CCTGCAAGACAGACAGTGGA AGG | Intronic | ||
No off target data available for this crispr |