ID: 1049033971

View in Genome Browser
Species Human (GRCh38)
Location 8:140060470-140060492
Sequence GCAGAGTGCAGGAGGCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 1, 2: 2, 3: 48, 4: 445}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049033971 Original CRISPR GCAGAGTGCAGGAGGCCAAG GGG (reversed) Intronic
900300403 1:1974057-1974079 GCAGAGAGCAGGAGGCCCTGGGG - Exonic
900608223 1:3533264-3533286 GCAGAGTGTTGGGGGCCAAGGGG - Intronic
900696398 1:4013914-4013936 GCAGAAGGCAGGAGGGCAAGAGG + Intergenic
901201222 1:7468523-7468545 CCAGAGGGCAAGAGGCCAGGTGG - Intronic
901468238 1:9437354-9437376 GCAGAAAGCAGGAGGGCGAGGGG - Intergenic
901476124 1:9490801-9490823 GGAAAGGGCAGGAGGCCCAGGGG + Intergenic
901932932 1:12608546-12608568 GCAGGGGGCAGGAGGAAAAGAGG - Intronic
902392936 1:16116615-16116637 GCAGAGGGCAGGGGGCCGGGTGG - Intergenic
902968422 1:20029209-20029231 GGAGAGCGCAGGGTGCCAAGCGG - Intronic
903324958 1:22564178-22564200 TCAGAGGGCAGAAGGCAAAGGGG + Intronic
903680124 1:25090899-25090921 GCAGGGTGGAGGAGGCAAAGGGG + Intergenic
904054038 1:27658699-27658721 GCAGAGGGAAGGAGGCAAGGAGG + Intergenic
904344086 1:29856805-29856827 GCAGAGAGCAGAGGGCCAATGGG - Intergenic
904877114 1:33663654-33663676 GCAGACCTCAGGAGGCCAGGTGG + Intronic
905009733 1:34739255-34739277 CCAGAGAGCAGCAGGCCCAGAGG - Intronic
905401683 1:37708247-37708269 GCTGACTGTGGGAGGCCAAGGGG + Intronic
905899302 1:41570642-41570664 GCAGTGTCCAGGAAACCAAGAGG + Intronic
905925310 1:41745508-41745530 GCAGAGTGTTGGAGGCCTAGTGG - Intronic
908298284 1:62735438-62735460 GCAAAGAGGAGGAGTCCAAGTGG - Intergenic
909793279 1:79701562-79701584 GCAGAGAGCAGGAGGACGGGGGG + Intergenic
911728478 1:101267091-101267113 TCATAGTGGAGAAGGCCAAGTGG + Intergenic
912410426 1:109477444-109477466 GCAGACTGCAGGACGCAAATGGG - Intronic
912454913 1:109790915-109790937 GGAGGGTGCAGGAAGCCCAGAGG + Intergenic
912734849 1:112141641-112141663 CCACAGTGCAGGAGACCCAGAGG - Intergenic
913212541 1:116593600-116593622 GGAGAGAGCAGGGAGCCAAGGGG - Intronic
913228619 1:116722112-116722134 ATAGAATGCAGGAGGCCAGGAGG + Intergenic
914889921 1:151612811-151612833 GCAGAATGCAGCACGCCAAACGG - Intronic
915346673 1:155201069-155201091 GCAGGGAGCAGGCGGGCAAGGGG - Intronic
915474743 1:156147017-156147039 GAAGTGGGCAGGAGCCCAAGGGG + Intergenic
915497874 1:156294178-156294200 GCTGTGTGCAGGAGGCGAGGGGG + Exonic
915541415 1:156569375-156569397 GCCGGCTGGAGGAGGCCAAGCGG - Exonic
916047035 1:161007529-161007551 TCAGATTTGAGGAGGCCAAGTGG - Intronic
919257446 1:195142346-195142368 GCAGAGGGGAGGAGGACAGGAGG - Intergenic
919779469 1:201212915-201212937 GGAGGGTGCACCAGGCCAAGAGG + Exonic
919796337 1:201323459-201323481 GCAGAGCCCAGGAGGCCAGCTGG - Intronic
919913741 1:202127797-202127819 GCAGGGTGCTGGTGGCCACGTGG - Exonic
920292051 1:204929990-204930012 TCAGAGGGCAGGAGGGGAAGTGG + Intronic
921372981 1:214444619-214444641 GCAGATTGCAGGAGTCTAAGGGG + Intronic
921404645 1:214765300-214765322 GAAGAGGCCAGCAGGCCAAGGGG + Intergenic
922052419 1:222006261-222006283 GAAGATTGCTGGAGCCCAAGAGG - Intergenic
923667098 1:236008242-236008264 GCAGCGTGCAGAAGACAAAGAGG + Intronic
924266961 1:242292022-242292044 GCAGCGTTCAGGAAGCCAAGGGG + Intronic
1063703043 10:8404170-8404192 GCAGGGGGCAGGAGGACAGGAGG + Intergenic
1064709582 10:18109752-18109774 GATGAATGCAGGAGCCCAAGTGG - Intergenic
1065286867 10:24194989-24195011 TCCAAGTGCTGGAGGCCAAGAGG + Intronic
1066242113 10:33548091-33548113 GCAGAGTGCAGGTGGTAATGAGG + Intergenic
1066717856 10:38306474-38306496 GCAGCGTTCAGGAAGCCAAGGGG - Intergenic
1067046282 10:42987037-42987059 GCAGCCTGCAGGAGGCTCAGCGG - Intergenic
1067166485 10:43869789-43869811 GCAGAGTGCAGAAGCCCACCCGG + Intergenic
1067352406 10:45488253-45488275 GCAGATTTCAGGCGGCCAGGTGG + Intronic
1067695756 10:48534418-48534440 GGAAAGAGCAGGAGGCCATGGGG + Intronic
1067976484 10:51031509-51031531 GCAGAGGGCAGGAGGTGAATGGG + Intronic
1069691699 10:70357898-70357920 TCCGAGTGGAGGAGGCCACGTGG + Intronic
1071506730 10:86236884-86236906 GCAGAGAGCAGGAGGCAGAGTGG + Intronic
1072871589 10:99125970-99125992 GCAGAATCCAGGAGGCGAATGGG + Intronic
1073015951 10:100399266-100399288 GCAGACTGGAGGAGGCCAGTCGG + Intergenic
1073337171 10:102718504-102718526 GCAGCCTGCAGGAGGCCAGGTGG + Intronic
1073584114 10:104692209-104692231 GCAGAGTGTGGGAGGCCTTGGGG + Intronic
1074269990 10:111944587-111944609 GCTGAATCCAGGAGGCCCAGCGG + Intergenic
1074402272 10:113151933-113151955 CCAGAGTGCAGCAGGTCAGGTGG + Intronic
1074502953 10:114043412-114043434 GCCGAGTGCTGGAGGCAAACGGG + Intergenic
1076600743 10:131655395-131655417 TCAGAGTGCAGGTGTCCTAGAGG + Intergenic
1076612567 10:131735835-131735857 CCAGGATGCAGGTGGCCAAGAGG + Intergenic
1076727704 10:132421236-132421258 GCAGGGTGCAGGGAGCCCAGCGG - Intergenic
1076730841 10:132438186-132438208 ACAGAGTGTAGCAGGCCAGGTGG - Intergenic
1076746993 10:132519497-132519519 TCAGAGGGCAGGAGGCCCCGTGG + Intergenic
1077257336 11:1592574-1592596 GAAGAGGGCAGGAGACCTAGTGG + Intergenic
1077300179 11:1843099-1843121 CCAGGGTGTAGGAGGCCATGAGG + Intergenic
1077316093 11:1920008-1920030 GCAGAGTGTGGGAGGCCAGGAGG + Intronic
1077353950 11:2106101-2106123 CCAGAGTGCAAGAGGAGAAGTGG - Intergenic
1077428326 11:2498650-2498672 GCTGAGGCCAGGAAGCCAAGTGG - Intronic
1079004506 11:16782531-16782553 ACACAGTGGAGGAGACCAAGGGG - Intronic
1079197601 11:18343921-18343943 GCAGATTGCTTGAGCCCAAGAGG - Intronic
1079398590 11:20087027-20087049 TCAGAGGGCAAGAGGGCAAGAGG + Intronic
1081790126 11:45776543-45776565 GCAGGGTTAAGGAGGCTAAGAGG - Intergenic
1081869173 11:46375583-46375605 CCATGGTGCAGAAGGCCAAGCGG + Exonic
1082084441 11:48038057-48038079 ACAGAGAGCAGCAGACCAAGAGG - Intronic
1083355291 11:62061728-62061750 GCAGAACGGCGGAGGCCAAGTGG - Intergenic
1083600591 11:63945203-63945225 GCAGAGGGCAGGGGCCCAAAGGG - Intronic
1083742673 11:64719363-64719385 GCAGAGTTGAGGAGGACACGAGG - Intronic
1084571242 11:69961184-69961206 GCACAGTGCAGGGGGTCATGGGG + Intergenic
1084605186 11:70168177-70168199 GCAGAGTGCAGGAGGCAGGAGGG - Intronic
1085460555 11:76690532-76690554 GCAGAGGGTCGGAGGGCAAGGGG - Intergenic
1085751221 11:79162795-79162817 GCAGTGTGCAGGAGCCCATTGGG + Intronic
1087328695 11:96753602-96753624 GCAGAATCCAGGGAGCCAAGCGG - Intergenic
1089432594 11:118436383-118436405 GCAGGGTGCAGGCGGCCGGGCGG + Intergenic
1089597496 11:119590205-119590227 GCAGAGAGCATGAGGCCAAGAGG + Intergenic
1089622247 11:119728795-119728817 GGAGAGCGGAGGAGGCGAAGGGG - Exonic
1090382180 11:126335190-126335212 GCAGAGAGCAGGAGGTGATGAGG + Intronic
1090442094 11:126732802-126732824 GCAGAGTGGAAAAGGCCAGGGGG + Intronic
1090685626 11:129115242-129115264 ACTGAGTTCAGGACGCCAAGAGG + Intronic
1091563341 12:1630416-1630438 ACAGCAGGCAGGAGGCCAAGAGG + Intronic
1091817928 12:3453775-3453797 ACAGCGGGCAGGAGGACAAGGGG - Intronic
1091833796 12:3569861-3569883 GCAGAGATCAGCAGGGCAAGTGG + Intronic
1092602478 12:10082155-10082177 GCAGAATCCAGGGGGCAAAGAGG + Intronic
1092713674 12:11365504-11365526 GCTGAGTACAGGAAGACAAGAGG + Intronic
1092717377 12:11404690-11404712 GCTGAGTACAGGAAGACAAGAGG + Intronic
1093934749 12:24988641-24988663 GCAGTGTCCTGGAAGCCAAGTGG - Intergenic
1095752768 12:45729601-45729623 GGAGGGAGCAGGAGGCCAGGGGG - Intergenic
1095957253 12:47813796-47813818 GCAGTGTGCAGGGGGAAAAGCGG + Intronic
1096503312 12:52078649-52078671 CCAGACTGCAGCAGGCCAAGTGG - Intergenic
1096715217 12:53487115-53487137 GCAGGATGCAGGGGGCCCAGGGG - Exonic
1096745169 12:53722076-53722098 GCCGAGTGCAGGAGCTCGAGAGG - Exonic
1097615478 12:61879669-61879691 ACAGGATGCTGGAGGCCAAGTGG + Intronic
1101873717 12:108584946-108584968 GCAGAGTGAAAGAAGCCAGGCGG + Intergenic
1102247784 12:111366124-111366146 GCAGAGGGCAGGGAGGCAAGTGG - Exonic
1103524510 12:121558957-121558979 GCAAAGTAGCGGAGGCCAAGAGG - Intronic
1103774258 12:123354481-123354503 GCAGGGTGAAGGAGGGAAAGGGG + Intronic
1103848951 12:123918605-123918627 GCAGAGGGCAGGAGGGGCAGGGG - Intronic
1104065414 12:125301447-125301469 GCAGACAGCATGAGGCAAAGAGG - Intronic
1105215785 13:18284223-18284245 GGAGAGAGCAGGGAGCCAAGGGG - Intergenic
1105279161 13:18953169-18953191 GCATTGTGTAGGAGGCCATGGGG - Intergenic
1106226918 13:27792970-27792992 GCAGAGTGCTGGCGGCCCAGGGG - Exonic
1106624771 13:31409299-31409321 GCAGAGGGCCAGGGGCCAAGTGG + Intergenic
1106727149 13:32497635-32497657 GCAGAGTGCTGGAGGAAAAATGG + Intronic
1107252562 13:38381480-38381502 GCAGAAGGCAGGAGGGCAAGAGG + Intergenic
1107787456 13:43970285-43970307 CCATGGTGCAGAAGGCCAAGCGG + Intergenic
1110735262 13:78928758-78928780 ACAGAGGGCAGGGGGCCATGGGG - Intergenic
1111584069 13:90261659-90261681 TCACAGTCCAGGAGGCCTAGGGG - Intergenic
1111858758 13:93674049-93674071 GCAGGGGGCAAGAAGCCAAGTGG + Intronic
1112290351 13:98140618-98140640 GCTGAGGGCAGGAGCCCATGGGG - Intergenic
1112625281 13:101096969-101096991 ACAGAAAGGAGGAGGCCAAGAGG - Intronic
1113174449 13:107546142-107546164 CCAGGGTGCAAGAGGCCAAGTGG - Intronic
1113518691 13:110922558-110922580 GCAGGGCACAGGAGCCCAAGAGG - Intergenic
1113756116 13:112812321-112812343 GCAGGGTGCACGAGGACCAGTGG - Intronic
1113879419 13:113615420-113615442 GGAGAGTGCAGGCAGCCATGGGG - Intronic
1113891078 13:113735924-113735946 GCAGGGTGCAGGGGACCATGTGG - Exonic
1114265687 14:21071361-21071383 GCAGAGTGGAGGAGGGGGAGAGG + Intronic
1114916443 14:27272712-27272734 GAAGATTGCTTGAGGCCAAGAGG + Intergenic
1115566458 14:34629617-34629639 GCGGGGTGCAGGTGGCGAAGTGG - Intronic
1115705586 14:35994741-35994763 GCAGTGGGCAGAAGGGCAAGAGG - Intergenic
1115996709 14:39202903-39202925 GCAGAGTGAAATAGGGCAAGGGG - Intergenic
1116329282 14:43576306-43576328 AGAGAGTGGAGGAGACCAAGTGG - Intergenic
1117073119 14:52074070-52074092 GCAGAGGGGAAGAGGCCAACAGG - Intergenic
1117388547 14:55240996-55241018 GCGGAATGCAGGAGGCCTCGAGG + Intergenic
1118762366 14:68888415-68888437 GCAGAGTGGAGGAGGCACAGTGG - Intronic
1118885556 14:69863031-69863053 GCAGAGGGGCTGAGGCCAAGGGG + Intronic
1118979688 14:70706468-70706490 GCAGAGTGCAGGAAAACAAGGGG - Intergenic
1120997212 14:90425980-90426002 ACAGATTGCAGTAAGCCAAGAGG + Intergenic
1121428514 14:93870900-93870922 GCAGAAGGCAGAAGGACAAGAGG - Intergenic
1121439926 14:93942134-93942156 GCAGAGGACAGGAGGACAAGGGG + Intronic
1122275961 14:100590947-100590969 GCAGTGGGGTGGAGGCCAAGGGG - Intergenic
1122729537 14:103785734-103785756 CCTGAGGCCAGGAGGCCAAGAGG - Intronic
1122921504 14:104882319-104882341 ACAGAGGGCAGGAGGCCAGGGGG - Intronic
1123939887 15:25211712-25211734 GCTCAGTGCAGGAGATCAAGGGG - Intergenic
1123950197 15:25264342-25264364 CCTGGGTGCAGCAGGCCAAGTGG - Intergenic
1126439978 15:48676921-48676943 GCTGAGTGTGGGAGGACAAGGGG - Intergenic
1127693233 15:61418456-61418478 GCAGAGTGCATGAAGCAGAGGGG - Intergenic
1127845905 15:62870701-62870723 GGAGAGTGGAGGATGGCAAGAGG - Intergenic
1128591790 15:68904501-68904523 GCAGAAGGCAGAAGGGCAAGAGG + Intronic
1129062210 15:72869132-72869154 CCAGAGAGCAGGAGGTCAAGGGG - Intergenic
1129348222 15:74937938-74937960 GCGGAGTGCAGGAGGCCTCGAGG + Exonic
1129515300 15:76153616-76153638 GCAGAGGGCAGGAGGGGAACCGG + Intronic
1129942275 15:79508827-79508849 GGAGAGAGGAGGATGCCAAGAGG - Intergenic
1130062122 15:80577691-80577713 GCAGAGGCCAGGAGGGCAGGTGG + Intronic
1130950847 15:88586413-88586435 TTTGACTGCAGGAGGCCAAGGGG - Intergenic
1131560739 15:93437235-93437257 GCAGAAGGCAGAAGGGCAAGGGG - Intergenic
1132727923 16:1346742-1346764 GCAGGGTGCCGGAGGCCCTGTGG + Intronic
1132727954 16:1346843-1346865 GCAGGGTGCTGGAGGCCCTGTGG + Exonic
1132737323 16:1393437-1393459 GCAGCGTGGAGGAGGCCGCGTGG + Intronic
1132737342 16:1393506-1393528 GCAGCGTGGAGGAGGCCGCGTGG + Intronic
1132745117 16:1433266-1433288 CCAGGGTGCAGCAGGCCCAGGGG - Intergenic
1132759477 16:1501798-1501820 GCAGCGTGCAGGAGGCCGGGAGG + Intronic
1133008664 16:2898224-2898246 GCAGAGGGATGGAGGCCGAGGGG - Intronic
1133496634 16:6324473-6324495 GCAGAAGGCAGAAGGCAAAGGGG + Intronic
1133771341 16:8868692-8868714 GCAGAGAACAGGTGGCCAGGCGG + Intronic
1133970886 16:10567379-10567401 TCAGAGAGCTGGAGGCCATGGGG - Intronic
1134273222 16:12753461-12753483 GCAGAGAACAGAAGGCCATGCGG + Intronic
1135184166 16:20300425-20300447 GCAGAGTGGAGAATGCCAAGAGG + Intergenic
1135905852 16:26511160-26511182 GCACAGTGCAGGGGACCAAGAGG + Intergenic
1136402398 16:30025690-30025712 GGAGGGTGCAGGAGCCCAATGGG - Intronic
1138379796 16:56591779-56591801 GGAGAGTCCAGGAGGCCCAGGGG + Intergenic
1138535817 16:57659783-57659805 GATGAGTGAAGGAGGCCAGGAGG - Intronic
1139247810 16:65463502-65463524 ACAGGGAGCAGGAGGCCACGTGG - Intergenic
1140734310 16:77884472-77884494 GCAGATTCCAGCTGGCCAAGGGG - Intronic
1141846824 16:86615569-86615591 GTAGGGAGCGGGAGGCCAAGGGG - Intergenic
1141929289 16:87190722-87190744 GCCCATTGCAGGATGCCAAGTGG - Intronic
1141999468 16:87655938-87655960 GCAGAGACCAGGAGGGCATGTGG - Intronic
1142040692 16:87891912-87891934 GCAGAGTGGAGGGGTCGAAGGGG + Exonic
1142280576 16:89145678-89145700 GGAGAGTGCAGAGAGCCAAGGGG + Intronic
1142580210 17:937312-937334 GAAGAGCCCAGGAGTCCAAGAGG + Intronic
1142754775 17:2009724-2009746 GCAGCGGGCAGGAGGAGAAGTGG - Intronic
1143674701 17:8423457-8423479 GCAGATTGCCTGAGGCCAGGCGG + Intronic
1144547915 17:16215191-16215213 GCCGAGTGGAAGAGGCCAGGCGG + Intronic
1145732855 17:27205581-27205603 GCAGATTGCTTGAGGCCAGGAGG - Intergenic
1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG + Intronic
1146650032 17:34601002-34601024 GCAGAATCCAGGAGGCCATTGGG + Intronic
1147267417 17:39243285-39243307 GCTGAGTGCAGGTGGTCTAGCGG - Intergenic
1148286244 17:46395450-46395472 GAAGATTGCTTGAGGCCAAGAGG + Intergenic
1148885100 17:50766754-50766776 GCAGAGTGGCGGAGGCCACAGGG + Intergenic
1149627304 17:58088888-58088910 GTAGAGTGCTGGAGGCTCAGGGG + Intronic
1150025411 17:61669009-61669031 GAAGACTGCAGGAGGCCAATAGG + Intergenic
1150225622 17:63523160-63523182 GCAGAGGAGAGGAGGCCAGGAGG + Intergenic
1150652981 17:67021891-67021913 GCACAGCGCAGGTGGCTAAGGGG - Intronic
1150809683 17:68346791-68346813 GCAAAGTGAAGGAGCCCATGTGG + Intronic
1150998552 17:70347530-70347552 GCAGAAGGCAGAAGGACAAGTGG + Intergenic
1151146464 17:72046238-72046260 TAGGACTGCAGGAGGCCAAGAGG + Intergenic
1152092107 17:78252749-78252771 GGAGAGTGCAGGAGGCTCTGAGG - Intergenic
1152154768 17:78625775-78625797 GCAGAGTGCAGGAGCCCTGTAGG - Intergenic
1152315059 17:79575327-79575349 GCAGAGTGAGGGAGACAAAGGGG + Intergenic
1152896563 17:82914636-82914658 GGGGAGTGCAGGCAGCCAAGGGG - Intronic
1153293121 18:3520876-3520898 GCAGAGTCCAGAAGGTGAAGAGG - Intronic
1153958628 18:10121248-10121270 GCAGAGAGCAGAAGGGCGAGTGG + Intergenic
1153963126 18:10157000-10157022 ACAGAGGGCAGAAGGGCAAGAGG - Intergenic
1156009776 18:32483394-32483416 GAAGAGTGCAGTTGGCTAAGTGG + Intergenic
1157286448 18:46380363-46380385 GCAGGCTGAAGGAGGCCCAGAGG + Intronic
1157325893 18:46668747-46668769 GCAGAGTGTGGGAGCCCCAGGGG + Intronic
1160293517 18:77617019-77617041 GGGGTGTGCAGGAGGCCATGGGG + Intergenic
1160533121 18:79577004-79577026 GCTGAGTGCATGGGGCCGAGAGG + Intergenic
1160861041 19:1237365-1237387 GAAGATGGCAGGAGGCCGAGGGG + Intronic
1161006871 19:1941444-1941466 CCAGGGTGCAGGGGGCGAAGGGG - Intronic
1163493351 19:17630291-17630313 GCAGGGGGAAGGAGGCCAAGAGG + Intronic
1164510484 19:28892761-28892783 GCTGAGGGCAGGAGGGAAAGAGG - Intergenic
1164917850 19:32066225-32066247 TCAGGGTGCAGGAGGCGAGGCGG - Intergenic
1165726349 19:38115576-38115598 GCAAGGAGCAGGAGGCCATGAGG - Intronic
1166435608 19:42764568-42764590 GCAGTGTGGAGGGGGCCATGCGG - Intronic
1166445477 19:42854601-42854623 GCAGTGTGGAGGGGGCCATGCGG - Intronic
1166465149 19:43025345-43025367 GCAGTGTGGAGGGGGCCATGCGG - Intronic
1166822422 19:45588627-45588649 GGTGACTGCAGGAGTCCAAGAGG - Intronic
1166846838 19:45733666-45733688 GGCGGGTGCTGGAGGCCAAGGGG + Exonic
1166949923 19:46420207-46420229 ACAGAGTGGAGGAGGCGATGTGG + Intergenic
1167195565 19:48025813-48025835 GGAGACTGCAGGAAGACAAGGGG - Intergenic
1167616723 19:50538656-50538678 GAAGATTGCATGAGGCCAGGAGG - Intronic
1167791972 19:51688880-51688902 GCAGAGAGGAGGAGGGAAAGAGG + Intergenic
1168115673 19:54220377-54220399 TCAGAGGGGAGGAGGCCAACAGG - Intronic
1168118660 19:54240123-54240145 TCAGAGGGGAGGAGGCCAACAGG - Intronic
1168317690 19:55491178-55491200 GCAGAGAGCAGGCGGGCAGGAGG - Intronic
925284256 2:2705635-2705657 GCAGAGAGCAGGAAGCCACAGGG + Intergenic
925285655 2:2714090-2714112 GCAGAGTCAAGGAAGCCAACGGG + Intergenic
926010030 2:9400245-9400267 GAAGAGGGCAGGAGGGGAAGGGG - Intronic
926832524 2:16979112-16979134 GAAGATTGCTTGAGGCCAAGAGG + Intergenic
927644800 2:24870765-24870787 GCCGAGTGCACGGGGCCATGAGG - Intronic
927863214 2:26573393-26573415 GCAGAGGGGAAGAGGCCGAGAGG + Intronic
928928265 2:36599574-36599596 GCAAAGAGCAGGAGGACAGGGGG - Intronic
929475851 2:42247470-42247492 CCAGAGTACATGAGGCCAAGAGG - Intronic
929910510 2:46085591-46085613 TCAGGGAGGAGGAGGCCAAGTGG - Intronic
930487602 2:52027117-52027139 GCAAAGAGCAGGAGGACAGGGGG + Intergenic
931356102 2:61538515-61538537 GCAGAGTGGGGGAGGGGAAGTGG + Intronic
931853779 2:66280534-66280556 TCTGAGTTCAGGAGGCAAAGGGG - Intergenic
932790371 2:74649647-74649669 GCAGAAGGCAGAAGGGCAAGGGG + Intergenic
933482534 2:82875730-82875752 GCTGAATCCAGGAAGCCAAGTGG + Intergenic
933979460 2:87538547-87538569 GCAGAGGGCAGGGGGACGAGGGG - Intergenic
934041221 2:88129141-88129163 ACAGAGTAGAGGAGGCCCAGAGG - Intergenic
934298546 2:91762502-91762524 GGAGAGAGCAGGGAGCCAAGGGG + Intergenic
935753853 2:106262059-106262081 GCTGAGTGCTGCAGGCCAGGAGG + Intergenic
935869919 2:107436549-107436571 GCAGAAACCAGGAGGCCAAAAGG - Intergenic
936285030 2:111175064-111175086 CCAGATTACAGGAGACCAAGGGG + Intergenic
936314363 2:111412244-111412266 GCAGAGGGCAGGGGGACGAGGGG + Intergenic
936490798 2:112970500-112970522 GCAGAGTGGAGGAGGCCAGATGG + Intergenic
936513807 2:113169006-113169028 GCAGAAGCCAGGAGACCAAGAGG - Intronic
937225350 2:120365645-120365667 GCAGTGAGCAGGTGGCCAAGGGG + Intergenic
937398973 2:121564937-121564959 GGAGAATGCAGGTGGACAAGGGG + Intronic
938086624 2:128406142-128406164 GTAGAGGGGAGGAGGCCACGTGG + Intergenic
939988937 2:148859244-148859266 CAAGTGTGCAGGAGGTCAAGTGG - Intergenic
940788095 2:158003268-158003290 GCAGAGTGCTGGAGACCAGTGGG + Intronic
940790435 2:158025474-158025496 GCAGGGTACAGGAGGCCTTGAGG + Intronic
941224546 2:162830759-162830781 GCAGAATGCAGAAGGCTAAAAGG - Intronic
941508393 2:166376008-166376030 GAGGAGTGGAGGAGGCAAAGCGG - Intergenic
941843159 2:170109212-170109234 GCAGAGAGGAAGAAGCCAAGAGG - Intergenic
942108348 2:172655703-172655725 GACAAGTGCAGGAGCCCAAGTGG + Intergenic
943656518 2:190514487-190514509 GCAGACTCCAGGAGGACATGAGG + Exonic
944843597 2:203646655-203646677 GCAGACTGCAGGACTACAAGAGG - Intergenic
946409648 2:219509651-219509673 TCAGAGAGCAGGAGGGCAGGGGG + Intergenic
946648679 2:221868275-221868297 GCTGAATCCAGGAAGCCAAGTGG + Intergenic
946724053 2:222643753-222643775 GCAGAATGAAGGCAGCCAAGAGG + Intronic
947098371 2:226592157-226592179 GCTGAGTCCAGGGAGCCAAGTGG - Intergenic
947231282 2:227889378-227889400 GCAGAGGGCAGAAGGGCAAAAGG + Intronic
947815068 2:233031554-233031576 GCAGAGGGCAAGTGGGCAAGAGG - Intergenic
947825991 2:233106381-233106403 GCAGATTGCAGGGGCCCAGGAGG + Intronic
948619997 2:239228241-239228263 GCAGCCTGCTGGAGGCCATGTGG + Intronic
948650304 2:239439700-239439722 GCAGAGTGCCGGAGGCCAAGGGG - Intergenic
948841404 2:240651422-240651444 GCAGAATCCAGGAGAACAAGAGG - Intergenic
948883030 2:240870011-240870033 GCAGAGGCCAGGACCCCAAGTGG + Intronic
1168816857 20:743590-743612 GAAGAGTGCTCCAGGCCAAGGGG - Intergenic
1168956245 20:1836461-1836483 GCAGAGTGAAGGAGGTGGAGAGG - Intergenic
1168975054 20:1958590-1958612 GCAGAGGGCAGAAGGGCAAAAGG - Intergenic
1170443168 20:16398886-16398908 GCACAGAGGAGGAGGCCAGGAGG + Intronic
1170603378 20:17858909-17858931 GCAGGCAGGAGGAGGCCAAGGGG - Intergenic
1171283781 20:23921724-23921746 GCAGGTTAAAGGAGGCCAAGTGG + Intergenic
1172195075 20:33086003-33086025 TAAGACTGGAGGAGGCCAAGGGG - Exonic
1172634915 20:36403869-36403891 GCTGATGGCAGGAGGCCACGTGG + Intronic
1173659424 20:44723105-44723127 GCAGAGAGCAGGAGGAGAGGAGG - Intronic
1173949569 20:46979341-46979363 GCAGGCAGCAGCAGGCCAAGGGG + Intronic
1174189278 20:48728654-48728676 GCAGAGTGCAGGGCGCCTGGGGG + Intronic
1174361119 20:50029548-50029570 GCAGAGTGGGCGAGGCCAGGAGG + Intergenic
1174550332 20:51357305-51357327 GCAGAGAGCAGGAGGGGATGAGG - Intergenic
1175260436 20:57670610-57670632 CCATAGGGCAGGGGGCCAAGTGG - Intronic
1175260829 20:57673130-57673152 CCAGGGTGCTGGCGGCCAAGAGG - Intronic
1175306934 20:57982663-57982685 GCAGAGGGCAGGAAGCCAGATGG + Intergenic
1175960116 20:62631606-62631628 GCAAAGTGCAGGTGGCGAGGTGG + Intergenic
1175967905 20:62668856-62668878 GCAGGGGGCAGGCAGCCAAGAGG - Intronic
1176044517 20:63085426-63085448 GCAGAGGGAGGGAGGCCACGGGG + Intergenic
1176411914 21:6453780-6453802 GGTGAGGGCAGGAGGCCATGGGG - Intergenic
1178505740 21:33161591-33161613 GCAGAGAGCAGGGGGACATGGGG - Intergenic
1178895753 21:36555526-36555548 AAAGAGTGCAGGAGCCCACGGGG + Intronic
1179687408 21:43062102-43062124 GGTGAGGGCAGGAGGCCATGGGG - Intronic
1179939043 21:44626607-44626629 ACAGAGGGCAGGAGGCACAGAGG + Intronic
1180045895 21:45304994-45305016 GCAGAAGGCAGGAGGGCAAAAGG - Intergenic
1180959538 22:19756392-19756414 GCTGAGTGCAGGAGGCTGAAGGG - Intergenic
1180962311 22:19767483-19767505 GCAGAGGGCAGGAGGCGTGGCGG - Intronic
1181136699 22:20772194-20772216 ACTGAGAGCTGGAGGCCAAGGGG + Intronic
1182056241 22:27357442-27357464 GCAGAGAGCAGGAGGAAGAGAGG - Intergenic
1182416028 22:30222029-30222051 GCCGAGTGCAAAAGGCCAGGTGG + Intergenic
1183111611 22:35653607-35653629 GCAGAAGGCAGAAGGGCAAGAGG + Intronic
1183298101 22:37043945-37043967 GCAGAGTCCACGGGGCCCAGGGG + Intergenic
1183361694 22:37386312-37386334 GCAGAGTGAGGGAGTCCATGGGG - Intronic
1183625733 22:39000294-39000316 GCAGAGTGGAGGAAGACACGAGG + Intergenic
1183738079 22:39654846-39654868 AGACAGTGCAGGAGGCCAGGAGG + Intronic
1184258916 22:43303337-43303359 GGATGGGGCAGGAGGCCAAGCGG - Intronic
1184506968 22:44909765-44909787 GCAGAGAACAGGAGGCAGAGGGG - Intronic
1185092663 22:48784822-48784844 GGAGAGTTCAGGGGGTCAAGGGG - Intronic
1185262635 22:49877841-49877863 GCAGAGTGCGGGAGGCCAAAGGG - Intronic
1185375766 22:50482006-50482028 GCAGAGTGCCGGGGGCCGCGGGG + Intronic
950520503 3:13495148-13495170 GCAGTGCTCAGGAGGCCAGGTGG - Intronic
951862314 3:27266851-27266873 GCAGTGTGCAGGATGCTTAGTGG + Intronic
952616370 3:35278322-35278344 GCTGAGTCCAGGGAGCCAAGCGG + Intergenic
952924213 3:38309362-38309384 GAAGAGTGTTGAAGGCCAAGGGG + Intronic
953128166 3:40111608-40111630 GGACAGTGCAGGAGTCCCAGGGG + Intronic
954893698 3:53957105-53957127 GAAGAGAGCAGGTGGCCAGGAGG - Intergenic
955015367 3:55064435-55064457 GCTGAGTGCAGGAGGGGAATAGG + Intronic
955228225 3:57078583-57078605 CCAGGGTGGAGGACGCCAAGGGG - Intronic
955476912 3:59346638-59346660 GCAGCATGCAGGAGACCCAGTGG - Intergenic
956560197 3:70566470-70566492 GCAGAGAGCAGGAGAGAAAGAGG + Intergenic
959195201 3:103171555-103171577 GCAGAAGGCAGAAGGGCAAGTGG + Intergenic
960294684 3:115928670-115928692 GCAGAGTGCAGGGGGTGAGGAGG + Intronic
961005473 3:123402448-123402470 GCAGGATGCTGGAAGCCAAGGGG + Intronic
961217293 3:125169610-125169632 GCAGAGTGGAGGTGGGCAAAGGG - Intronic
961737667 3:129012386-129012408 GGAGAGTGCTGGAGGCACAGGGG - Intronic
962335657 3:134527800-134527822 GGAGAGGCCAGCAGGCCAAGGGG + Intronic
963762246 3:149295522-149295544 GACAAGTGCAGGAGGCCAAGTGG - Intergenic
966320866 3:178699612-178699634 GGAGAGGCCAGGAGACCAAGGGG + Intronic
966405976 3:179598714-179598736 CCCTAGAGCAGGAGGCCAAGCGG - Exonic
966932524 3:184685162-184685184 GCAGGGAGCAGGAGGGGAAGTGG + Intergenic
967649837 3:191973248-191973270 GCAGAGAGCAGGAAGCCATGTGG + Intergenic
968764281 4:2459925-2459947 GCAGAGGGAAGGTGGGCAAGGGG + Intronic
969086978 4:4663958-4663980 GCAGAGGGCTGGGGGCCCAGGGG + Intergenic
969124993 4:4940565-4940587 GCAGCCTGCAGGAGGCAGAGAGG + Intergenic
969260710 4:6031543-6031565 GGCATGTGCAGGAGGCCAAGAGG + Intronic
969392947 4:6902801-6902823 GCCCAGTGCTGGAGGCCATGAGG - Intergenic
969401762 4:6960559-6960581 GCAGCTTTCAGGAGGCCAACAGG - Intronic
969930699 4:10628068-10628090 ACAGATTGGAGGAGGCCAAGAGG - Intronic
970579100 4:17458025-17458047 GCAGAGGGCAGAAGGCAAAAAGG - Intergenic
976068819 4:81218758-81218780 GCAGAGACCAGGAGACCTAGTGG - Intergenic
976352248 4:84073330-84073352 GAAGAGTGCAGCCAGCCAAGTGG + Intergenic
976926082 4:90497902-90497924 AGGGAGTGCAGGAGGACAAGAGG + Intronic
977426909 4:96877713-96877735 GCTGTGTGCAGGAGACAAAGAGG + Intergenic
977564769 4:98569507-98569529 GCAGAGTGCAGGATGGCTGGGGG + Intronic
978688873 4:111483316-111483338 GGAGAGGCCAGGAGACCAAGGGG - Intergenic
979295724 4:119030820-119030842 GAATATTGCAGGAGGCCAAAAGG + Exonic
980148230 4:129015426-129015448 GGAGAGGGCAGCAGACCAAGGGG + Intronic
983652022 4:170045068-170045090 GCAGAAGGCAGAAGGGCAAGAGG - Intergenic
984211831 4:176859340-176859362 GGGGAGTGGAGGAGTCCAAGAGG + Intergenic
985422208 4:189795606-189795628 GCAGAGCACAGGAAGCCAAGGGG - Intergenic
985924497 5:3005165-3005187 GCAATGGGGAGGAGGCCAAGAGG + Intergenic
985965303 5:3335212-3335234 GATGAGTGCATGAGGCCACGGGG - Intergenic
987872678 5:23641055-23641077 GCAGAGTGAAGGTGGCCGGGTGG - Intergenic
988844607 5:35115563-35115585 CCAGACTGCAAGAAGCCAAGAGG - Intronic
988870531 5:35384801-35384823 GGAGAGTCCAGAAGACCAAGGGG - Intergenic
991143521 5:63274115-63274137 GCTGAATCCAGGAGGCTAAGCGG - Intergenic
991187639 5:63828895-63828917 GCAGAGTGAAGGAGGGGAAAAGG - Intergenic
991220867 5:64214386-64214408 GCTGAGTGCAGGAAGTCCAGAGG - Exonic
991545075 5:67772649-67772671 ACACAGTACAGGAGGGCAAGAGG + Intergenic
991618744 5:68523225-68523247 GCAGACTTCAGGGGGCCTAGAGG - Intergenic
991660417 5:68945432-68945454 GGAGAAAGCAGGAGGCCAAAGGG + Intergenic
992623446 5:78616027-78616049 GCAGAAGGAAGGAGGACAAGAGG - Intronic
993168251 5:84384110-84384132 GCAGAGTGCGCGGGGCCGAGCGG - Intronic
993340878 5:86723796-86723818 TCAAAGTACAGGATGCCAAGAGG + Intergenic
993497553 5:88624573-88624595 TGAGAATGCAGGAGGTCAAGAGG - Intergenic
993803413 5:92374460-92374482 GCAGGCTGCAGGAGCCCCAGTGG - Intergenic
994076680 5:95659728-95659750 GCAGGAGGCAGGAGGGCAAGAGG - Intronic
996915494 5:128707415-128707437 GCAGAGAGGGAGAGGCCAAGTGG + Intronic
997681821 5:135761842-135761864 CCAAAGTGTGGGAGGCCAAGTGG - Intergenic
997843111 5:137260200-137260222 GAAGAGTGCGGGATGCCAGGAGG - Intronic
998386059 5:141757792-141757814 ACAGAGTGCAGGAGCCAAATGGG + Intergenic
998569021 5:143240396-143240418 GCTGAGGGCAAGAGGCCCAGAGG + Intergenic
999810923 5:155126548-155126570 GACAAGTGCAGGAGCCCAAGTGG + Intergenic
1000521722 5:162302888-162302910 GCAGAAGGCAGAAGGGCAAGAGG + Intergenic
1000693472 5:164350899-164350921 GCAAAGTGCAGCAGGTTAAGGGG + Intergenic
1001403749 5:171461510-171461532 GCATAGAGCAGGAGGGCAAGGGG - Intergenic
1001918627 5:175582873-175582895 GCAGAGTGCATGACGCATAGAGG - Intergenic
1002426777 5:179181305-179181327 GCAGAGGGCAGGGGGCAATGAGG - Intronic
1002434367 5:179221853-179221875 GCAGAGGGAAGGAGGACATGTGG - Intronic
1002596926 5:180329813-180329835 GCAGGGTGCGGGAGGACGAGAGG - Intronic
1002852939 6:1012398-1012420 GCACAGTGCTGGAGGGCAAGGGG + Intergenic
1003307766 6:4945065-4945087 TCAGACTGGAGGAGACCAAGGGG + Intronic
1003519694 6:6847813-6847835 GAAGAGGGCTGGAGGCCAGGCGG - Intergenic
1004392571 6:15221931-15221953 GCAGAGTCAAGGAGGCCACGTGG + Intergenic
1005012267 6:21347354-21347376 GAGGAGAGAAGGAGGCCAAGAGG + Intergenic
1005039514 6:21588430-21588452 CAAGAGAGCAGGGGGCCAAGTGG + Intergenic
1005473970 6:26189228-26189250 TCAGACTGGAGGAGACCAAGAGG + Intergenic
1006106271 6:31718838-31718860 GCAGAGTATAGGAAGCAAAGTGG + Exonic
1006114558 6:31768502-31768524 GCAGAATACTGGAAGCCAAGTGG + Intronic
1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG + Intronic
1007403927 6:41622401-41622423 ACAGAGTTCAAGAGGCCAACGGG - Intergenic
1007622468 6:43223415-43223437 GCAGAATGCAGGAGCAGAAGGGG - Intronic
1009716284 6:67400954-67400976 AGAGAGTGCAGGAGGCCAGTAGG + Intergenic
1010146332 6:72673607-72673629 GAGGAGTGGAGGAGGCGAAGAGG + Intronic
1010177931 6:73051318-73051340 GCAGAGTGCTGGTGGCCATGGGG - Intronic
1010801934 6:80186595-80186617 GCAGAGTCCAGGGGGCAAATGGG - Intronic
1013862273 6:114650079-114650101 GCAGAAGGCAGAAGGGCAAGAGG + Intergenic
1014613117 6:123568561-123568583 GCAGAGTGCAAGAGTTAAAGAGG - Intronic
1015923402 6:138287416-138287438 GGAAAGTGCAGCAGGCCCAGGGG + Intronic
1017806135 6:157947073-157947095 GCTGGGTGAGGGAGGCCAAGAGG + Intergenic
1018829552 6:167432915-167432937 GCAGAGTGGAAGAGGCCATGGGG + Intergenic
1018857491 6:167685065-167685087 ACAGAGAGGAGGAGGCCATGCGG - Intergenic
1019183015 6:170204093-170204115 GCAGAGTGAAGGAGGGGAAAAGG - Intergenic
1019447888 7:1080959-1080981 CCAGGGTGCAGGGGGCCAGGTGG + Intronic
1019564247 7:1671706-1671728 CCAGGGGGCAGGAGGCCAGGGGG - Intergenic
1019815579 7:3197434-3197456 GCAGAGGGCAGGAGGGGAATTGG + Intergenic
1020693833 7:11391558-11391580 GCTGAGGCCAGGGGGCCAAGTGG - Intronic
1020959462 7:14784599-14784621 GCAGATTGCTTGAGGCCAGGAGG - Intronic
1022115476 7:27256936-27256958 GCAGAGGCCAGGAGGTCAGGAGG + Intergenic
1023196222 7:37642231-37642253 GCTGAATCCAGGAAGCCAAGCGG - Intergenic
1024350166 7:48355386-48355408 GCAGAGTGCACAAGGGCAAGAGG + Intronic
1028420105 7:90623213-90623235 GCACAGTGCAGGATGTCAAATGG + Intronic
1028639713 7:93029025-93029047 GGAGAGGCCAGCAGGCCAAGGGG - Intergenic
1029240246 7:99155787-99155809 GCAGACTGCTGGAGCCCAGGAGG - Intergenic
1029469330 7:100744247-100744269 CAGGAGTGCAGGAGTCCAAGTGG - Intronic
1031146615 7:118003914-118003936 GCACAGTGGAGGAAGCAAAGAGG - Intergenic
1032516593 7:132510677-132510699 GCAGGCTGCAGGAGGCCTTGGGG + Intronic
1032870304 7:135977535-135977557 GCAGAATGAAGGAGGCCCGGGGG + Intergenic
1033038497 7:137896791-137896813 GTACAGGGAAGGAGGCCAAGGGG + Intronic
1033324331 7:140364934-140364956 CCAGAGTGCAGATGGCTAAGAGG - Intronic
1034447139 7:151119557-151119579 TTAGAGTGCAGGAGGCCAGGAGG - Intronic
1034543037 7:151771422-151771444 ACAGAGTGCAGGAGGAAAGGAGG - Intronic
1038331723 8:26614311-26614333 CCAGTGTGCAGTGGGCCAAGAGG + Intronic
1038922503 8:32100115-32100137 GCAGAGGGAAGGAGGAAAAGAGG - Intronic
1039113475 8:34065739-34065761 ACAAAGTGCAGGAGGTCAAGGGG + Intergenic
1040974756 8:53177579-53177601 GCAGTGGCCAGGAGGGCAAGTGG + Intergenic
1042729789 8:71920049-71920071 CCAGAGTGTGGGAGACCAAGGGG - Intronic
1042846065 8:73170565-73170587 GCAGAGAGCAGCAGTGCAAGAGG - Intergenic
1043499548 8:80838829-80838851 GCAGAGTGGAGGAGGAAGAGGGG + Intronic
1043837281 8:85062332-85062354 GCTCAGCCCAGGAGGCCAAGTGG + Intergenic
1044205017 8:89483583-89483605 CCAGAGTGCAGAATGCCAAGGGG + Intergenic
1044301868 8:90593777-90593799 GCAGAGTCCTGAGGGCCAAGGGG + Intergenic
1044313736 8:90726359-90726381 GGAGAGACCAGCAGGCCAAGGGG - Intronic
1045826398 8:106403367-106403389 GCAGTGTGGCAGAGGCCAAGTGG - Intronic
1047088239 8:121543594-121543616 GTAGAGTTCAGGAAGGCAAGTGG - Intergenic
1047204103 8:122789574-122789596 GGAGAGGCCAGGAGGCCAGGAGG + Intronic
1047532671 8:125691481-125691503 GCAGATGGCAGGAGGCCACACGG - Intergenic
1047666033 8:127092075-127092097 GCATTCTGCAGGAGGCCATGAGG - Intergenic
1047684473 8:127290863-127290885 GCAGAGTGTAGGAGGATAGGTGG - Intergenic
1049033971 8:140060470-140060492 GCAGAGTGCAGGAGGCCAAGGGG - Intronic
1049158970 8:141085235-141085257 GCAGAATGCACGAGCCCCAGAGG - Intergenic
1049178311 8:141207123-141207145 GCAGAGGGCAGGAGGCCACAGGG + Intergenic
1049190034 8:141282212-141282234 ACAGAGCCCGGGAGGCCAAGGGG + Intronic
1049693070 8:143971236-143971258 ACAGAGGGGAGGAGGCCAGGAGG + Intronic
1049707023 8:144047725-144047747 GGAGAGTGCAGGAAGCTGAGGGG + Intergenic
1052142531 9:25004431-25004453 GGAGAGTTCATTAGGCCAAGGGG + Intergenic
1052366219 9:27614899-27614921 GCAGAATCCAGGGAGCCAAGTGG - Intergenic
1052821783 9:33143203-33143225 GCAGACCGTAGGTGGCCAAGTGG + Intronic
1053199315 9:36142035-36142057 GCAGAGTGCAGGTTACCAGGGGG - Intronic
1053273897 9:36769116-36769138 GCTGAGTGTGGGAGGACAAGAGG + Intergenic
1053482771 9:38428245-38428267 GCAGGGAGGTGGAGGCCAAGTGG + Intergenic
1055207629 9:73751628-73751650 GAAGAGGGCTGGAGGGCAAGAGG + Intergenic
1055286039 9:74728869-74728891 GCAGTTTGCAGGAGAGCAAGTGG - Intronic
1056728287 9:89141868-89141890 GCAGGGTGGGGGAGGCGAAGAGG + Intronic
1056818049 9:89815985-89816007 TCACAGTGCAGGAGGCCGGGGGG - Intergenic
1056935530 9:90912792-90912814 GGAGAGAGCAGGAGGGCATGGGG - Intergenic
1057196026 9:93115942-93115964 GGAGAGTGAAGGAGGGCATGGGG + Intergenic
1057226682 9:93296519-93296541 GGAGAGGGGAGGAGGCCAAGGGG - Intronic
1057226828 9:93296979-93297001 GCGGAGGGGAGGAAGCCAAGGGG - Intronic
1057226869 9:93297105-93297127 GCCGAGGGGAGGACGCCAAGGGG - Intronic
1057273742 9:93665387-93665409 GCATTGTGTAGGAGGCCATGGGG + Intronic
1057493594 9:95542288-95542310 GCAGATTGCTTGAGGTCAAGAGG - Intergenic
1057515401 9:95716271-95716293 GGAGAGTACAGGAGGAGAAGTGG + Intergenic
1058902701 9:109456203-109456225 GCGGAGTGGAGAAGGGCAAGTGG - Intronic
1059367691 9:113799571-113799593 GCTGATTTCAGGAGGCAAAGGGG - Intergenic
1059385694 9:113962549-113962571 GCAGAGTACATGAGGACAAGAGG - Intronic
1060594797 9:124841472-124841494 GCAGAGGTCAGGGGGCCCAGAGG + Intergenic
1060768810 9:126315224-126315246 GCAGGGTGCAGGAGGATGAGAGG - Intergenic
1060787209 9:126460122-126460144 GCAGAGTGTTGCAGGCCCAGCGG - Intronic
1061387130 9:130296911-130296933 GGACCCTGCAGGAGGCCAAGTGG + Intronic
1061918384 9:133769081-133769103 GCAGAAAGCAGGTGGCCACGAGG - Intronic
1061938193 9:133870257-133870279 GCAGAGTGCAGGAAGAGAGGTGG + Intronic
1062038656 9:134394059-134394081 GCACAGTGGAGCAGGGCAAGGGG + Intronic
1062172471 9:135143027-135143049 GGAGTGTGCAGGAGGACTAGGGG + Intergenic
1062347931 9:136123992-136124014 GCAGCATGCAGGAGGCAGAGGGG - Intergenic
1062569546 9:137178829-137178851 CCCCAGGGCAGGAGGCCAAGGGG - Intronic
1062635965 9:137491989-137492011 GCAGAGAGCAGCAGGCACAGAGG + Intronic
1185503027 X:613371-613393 GAAGATTGCTTGAGGCCAAGAGG - Intergenic
1185599498 X:1329289-1329311 ACAGAGAGGAGGAGGCCACGTGG + Intergenic
1186301561 X:8204985-8205007 GCAGAGTGTAAGAGCCCAACTGG + Intergenic
1186664394 X:11703360-11703382 GCTGGGTGCAGGAGGGCAAGTGG - Intergenic
1191695418 X:63985356-63985378 GGAGAGTTCAGGAGACCAAGAGG - Intergenic
1194041881 X:88951304-88951326 GCAGGGAGGAGGAGGACAAGAGG + Intergenic
1196473790 X:116059022-116059044 GTAGAGGCCAGCAGGCCAAGAGG + Intergenic
1196830609 X:119772778-119772800 GCAGAGTGAGGGAGGGTAAGTGG - Intergenic
1197023230 X:121716478-121716500 GCTGAGTCCAGGGAGCCAAGTGG - Intergenic
1197114657 X:122818170-122818192 GCTGAGTCCAGGGAGCCAAGGGG + Intergenic
1197248107 X:124187434-124187456 GTAGAGTGCAAGAGGGCAATAGG - Intronic
1198806269 X:140498485-140498507 GAAGACTGCTTGAGGCCAAGAGG + Intergenic
1198851655 X:140970639-140970661 TAGGAGTGCAGGAGGCCATGAGG + Intergenic
1200169002 X:154058456-154058478 GCGGAGGTCAGGAGTCCAAGAGG - Intronic
1200336220 X:155353901-155353923 GCTGAATCCAGGGGGCCAAGCGG + Intergenic
1200350250 X:155487326-155487348 GCTGAATCCAGGGGGCCAAGCGG - Intergenic
1201327671 Y:12782093-12782115 GGAGATTGCAGTAAGCCAAGAGG - Intronic