ID: 1049034453

View in Genome Browser
Species Human (GRCh38)
Location 8:140063330-140063352
Sequence ATTGACTGCGTGGTGACGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049034453_1049034457 10 Left 1049034453 8:140063330-140063352 CCTCACGTCACCACGCAGTCAAT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1049034457 8:140063363-140063385 CTTTCACGAGCCAGGTAACACGG No data
1049034453_1049034455 2 Left 1049034453 8:140063330-140063352 CCTCACGTCACCACGCAGTCAAT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1049034455 8:140063355-140063377 TCACGTACCTTTCACGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049034453 Original CRISPR ATTGACTGCGTGGTGACGTG AGG (reversed) Intronic
912686535 1:111771958-111771980 ATTTCCAGGGTGGTGACGTGGGG - Intronic
917567173 1:176224863-176224885 GTTGAGTGCTTGGTGAAGTGGGG - Intergenic
924876768 1:248114917-248114939 ACTGACTGCGTGGATATGTGTGG - Intergenic
1063967158 10:11355092-11355114 ATTGGCAGCGTGGTTAGGTGAGG + Intergenic
1069777206 10:70934120-70934142 ATAGACTGCCTGGTGTGGTGGGG + Intergenic
1079591129 11:22184075-22184097 ATTGACTGAGTGGTTACATCTGG - Intergenic
1085866291 11:80298230-80298252 ATTCCCTGAGTAGTGACGTGGGG + Intergenic
1103657988 12:122489194-122489216 AATGATTGCGTTGTGACCTGGGG - Intronic
1118343284 14:64914481-64914503 GTTGACTGCGTCGCGATGTGTGG + Exonic
1127226799 15:56939774-56939796 ATTAGCTGAGTGGAGACGTGAGG + Intronic
1129228023 15:74181076-74181098 ATTGGCTGCATGGGCACGTGTGG + Intronic
1131814656 15:96209605-96209627 GTTGACTGAGTGCTGACGGGCGG - Intergenic
1136920877 16:34272278-34272300 AGTAACTGCGTAGTGATGTGTGG + Intergenic
1137444284 16:48522356-48522378 ACTGACTCCTTGGTGAGGTGGGG + Intergenic
1140740385 16:77936382-77936404 GCTGCCTGCGTGGTGACTTGAGG - Intronic
1149057006 17:52378784-52378806 ATAGACTGTGTGGTGACCAGTGG + Intergenic
1150220072 17:63491144-63491166 ACAGACTGCGTGCTGCCGTGGGG - Intronic
1152129510 17:78467411-78467433 CCTCACTGCGTGATGACGTGAGG + Intronic
1168575547 19:57505642-57505664 ACTGAATGTGTGGTGAGGTGGGG + Intronic
933423101 2:82077124-82077146 ATGGACTACGTGGTGGGGTGGGG + Intergenic
933800517 2:85956743-85956765 ATTCACTGAGTGGTGCCATGTGG + Intergenic
938207101 2:129433107-129433129 ATAGAGTGCGTGGTCATGTGTGG - Intergenic
948113165 2:235473258-235473280 ATTGACTTTGGGGTGACTTGAGG + Intergenic
1180010241 21:45044697-45044719 ATTGACTGGGGAGTGACGTGAGG + Intergenic
1184554855 22:45227607-45227629 AGTGACAGCCCGGTGACGTGAGG - Intronic
960534317 3:118799893-118799915 ATTGATTGGGTGGAGACCTGAGG - Intergenic
963015508 3:140820559-140820581 ATTGACTGGGTGGTGGGTTGGGG + Intergenic
965596880 3:170419148-170419170 AATGACTGGGTGGTGACCTGCGG + Exonic
972456187 4:39257964-39257986 ATTGACTGGGGGGTGACATGTGG - Intronic
975134728 4:70863526-70863548 ATTGACTCTGTGTTTACGTGAGG - Intergenic
993949302 5:94154167-94154189 ATTAACTGAGTGTTGACCTGTGG - Intronic
995400216 5:111732729-111732751 GTTGACTGTGGGGTGAGGTGGGG - Intronic
1005512718 6:26525790-26525812 ATTCACTGCGTGGTGGGGTGGGG + Intergenic
1007975654 6:46098763-46098785 ATTGACTGGGTGGTGACACCTGG - Intergenic
1017515242 6:155150501-155150523 AGTGACTGAGTGGTGGCTTGGGG + Intronic
1019424152 7:965622-965644 ATGAAGTGAGTGGTGACGTGTGG - Intronic
1019927828 7:4204950-4204972 AATGGCTGTGTGGTGAGGTGCGG + Intronic
1020389177 7:7640625-7640647 ATTGGCTGCTTAGTGACGCGCGG + Exonic
1026023220 7:66726711-66726733 ATGGACTGCGAGGTCAGGTGCGG + Intronic
1039388229 8:37155625-37155647 TTTTACTGCATGGTGACGTTAGG - Intergenic
1042764066 8:72301465-72301487 AATGACTGCATGGTGAACTGAGG - Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1047571432 8:126102770-126102792 ATTTACTGGGTGGTGATGTTAGG - Intergenic
1049034453 8:140063330-140063352 ATTGACTGCGTGGTGACGTGAGG - Intronic
1053394554 9:37761362-37761384 ATTGATTGCTTGGAGACGTCAGG + Intronic
1060885922 9:127152197-127152219 ATAGACTGTGTGGGGAGGTGTGG + Intronic
1191581490 X:62766906-62766928 AGAGACTGCTTTGTGACGTGTGG - Intergenic
1194043730 X:88974412-88974434 ATCGACTGAGAGGTGACATGAGG + Intergenic
1199364659 X:146966450-146966472 ATTGCTTGGGTGGTGATGTGTGG - Intergenic