ID: 1049034453

View in Genome Browser
Species Human (GRCh38)
Location 8:140063330-140063352
Sequence ATTGACTGCGTGGTGACGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049034453_1049034455 2 Left 1049034453 8:140063330-140063352 CCTCACGTCACCACGCAGTCAAT No data
Right 1049034455 8:140063355-140063377 TCACGTACCTTTCACGAGCCAGG No data
1049034453_1049034457 10 Left 1049034453 8:140063330-140063352 CCTCACGTCACCACGCAGTCAAT No data
Right 1049034457 8:140063363-140063385 CTTTCACGAGCCAGGTAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049034453 Original CRISPR ATTGACTGCGTGGTGACGTG AGG (reversed) Intronic