ID: 1049034457

View in Genome Browser
Species Human (GRCh38)
Location 8:140063363-140063385
Sequence CTTTCACGAGCCAGGTAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049034453_1049034457 10 Left 1049034453 8:140063330-140063352 CCTCACGTCACCACGCAGTCAAT No data
Right 1049034457 8:140063363-140063385 CTTTCACGAGCCAGGTAACACGG No data
1049034451_1049034457 28 Left 1049034451 8:140063312-140063334 CCGCTTCCTGTGCTCTCACCTCA No data
Right 1049034457 8:140063363-140063385 CTTTCACGAGCCAGGTAACACGG No data
1049034454_1049034457 0 Left 1049034454 8:140063340-140063362 CCACGCAGTCAATTCTCACGTAC No data
Right 1049034457 8:140063363-140063385 CTTTCACGAGCCAGGTAACACGG No data
1049034452_1049034457 22 Left 1049034452 8:140063318-140063340 CCTGTGCTCTCACCTCACGTCAC No data
Right 1049034457 8:140063363-140063385 CTTTCACGAGCCAGGTAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049034457 Original CRISPR CTTTCACGAGCCAGGTAACA CGG Intronic