ID: 1049035557

View in Genome Browser
Species Human (GRCh38)
Location 8:140073041-140073063
Sequence ATCCCACTGTACCATGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049035555_1049035557 4 Left 1049035555 8:140073014-140073036 CCAGAATGACTACAGTTTTAGAA 0: 1
1: 0
2: 1
3: 26
4: 292
Right 1049035557 8:140073041-140073063 ATCCCACTGTACCATGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049035557 Original CRISPR ATCCCACTGTACCATGGTGA AGG Intronic
No off target data available for this crispr