ID: 1049035632

View in Genome Browser
Species Human (GRCh38)
Location 8:140073954-140073976
Sequence TGCCTCACAGGATTGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049035632_1049035639 11 Left 1049035632 8:140073954-140073976 CCTCCCAGCAATCCTGTGAGGCA No data
Right 1049035639 8:140073988-140074010 CAGGAGAAGAAAATGAGACGTGG No data
1049035632_1049035636 -8 Left 1049035632 8:140073954-140073976 CCTCCCAGCAATCCTGTGAGGCA No data
Right 1049035636 8:140073969-140073991 GTGAGGCAAGTCCATTGTCCAGG No data
1049035632_1049035640 25 Left 1049035632 8:140073954-140073976 CCTCCCAGCAATCCTGTGAGGCA No data
Right 1049035640 8:140074002-140074024 GAGACGTGGAGAACCAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049035632 Original CRISPR TGCCTCACAGGATTGCTGGG AGG (reversed) Intronic