ID: 1049036106

View in Genome Browser
Species Human (GRCh38)
Location 8:140077513-140077535
Sequence CTGCCTCAGCCCTGGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 738
Summary {0: 1, 1: 0, 2: 5, 3: 66, 4: 666}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049036106_1049036115 27 Left 1049036106 8:140077513-140077535 CCTGAGCCCCAGGGCTGAGGCAG 0: 1
1: 0
2: 5
3: 66
4: 666
Right 1049036115 8:140077563-140077585 CTGCTTGCATGCATTTGAGCAGG No data
1049036106_1049036116 28 Left 1049036106 8:140077513-140077535 CCTGAGCCCCAGGGCTGAGGCAG 0: 1
1: 0
2: 5
3: 66
4: 666
Right 1049036116 8:140077564-140077586 TGCTTGCATGCATTTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049036106 Original CRISPR CTGCCTCAGCCCTGGGGCTC AGG (reversed) Intronic
900025342 1:267426-267448 CTCCTTCACCCCTGGGCCTCAGG + Intergenic
900028944 1:356808-356830 CTCCTTCACCCCTGGGCCTCAGG + Intergenic
900100391 1:959951-959973 CTCCCCCAGCCCTGGCGCTGAGG + Intergenic
900205642 1:1430998-1431020 CTGCCCCGGCACTCGGGCTCTGG - Intergenic
900351201 1:2235482-2235504 CTGGCTCACCCCGGGGGCTGGGG + Intronic
900386066 1:2411618-2411640 CAGCCTCATCCCTCGGGCTCAGG + Intronic
900436973 1:2635419-2635441 CTGCAGCAGCCCTGGGGCCAGGG + Intergenic
900626173 1:3609713-3609735 CTGCCTCTGCACCTGGGCTCGGG - Intronic
900641910 1:3691598-3691620 CAGCCTGAGCCCTGGGGACCTGG + Intronic
900898990 1:5504130-5504152 TGGGCTCAGCCCTGGGGCTGGGG + Intergenic
901089121 1:6629702-6629724 CTGGCACAGCCCAGGTGCTCGGG + Intronic
901705658 1:11071129-11071151 CTGCCTCAGAGCTCAGGCTCAGG + Intronic
902450494 1:16493880-16493902 ATGCCTCAGCCCTTGACCTCTGG + Intergenic
902616757 1:17627907-17627929 CGGCAGCAGCCCTAGGGCTCCGG - Intronic
902678851 1:18029104-18029126 CTGCCCCAGCACTGGGGCCTGGG - Intergenic
902715521 1:18270055-18270077 CTGGCTCTGCCTTGGGGCCCGGG - Intronic
902754517 1:18540299-18540321 ATGCCTCGGCCCTGGGGGCCTGG + Intergenic
902819099 1:18932751-18932773 CTGCCTCATCCCCGGGGCCTTGG - Intronic
903535406 1:24063306-24063328 CTGCCTCTGCCCTGGGGGGCAGG + Intronic
903780330 1:25816426-25816448 GTGCCTTGGCCCTGGGCCTCGGG - Exonic
904367333 1:30022697-30022719 CAGCCTCAGCTCTGGTGCTGAGG + Intergenic
904611441 1:31728140-31728162 CTGCCCCTGCCCTGAAGCTCAGG - Intronic
904650655 1:32003535-32003557 CAGGCTCAGGCCTGGGGCTGGGG - Intergenic
905010718 1:34745315-34745337 GTGCCTGAGCCCTTGGGCTATGG - Intronic
905244688 1:36604421-36604443 CAGCCTCAGCCCTGGTGTTCTGG + Intergenic
905450415 1:38052480-38052502 CTGCCTCAGCCCCTAGGCTGTGG + Intergenic
905587623 1:39133195-39133217 CTGCTTCCACCCTGGGGCTGGGG + Intronic
905772175 1:40645516-40645538 CAGACTCTGCCCTGGGTCTCTGG + Intronic
905803247 1:40859296-40859318 CTGTCTCTGGCCTGGGGTTCTGG + Intergenic
907525902 1:55053867-55053889 CTTCCCCAGGCCTGGTGCTCTGG + Intronic
909680621 1:78287550-78287572 CTGCCCCAGCTCTGTGGCTCAGG + Intergenic
909898922 1:81109082-81109104 GTGCCATAGCCCTGGGGCACAGG + Intergenic
909973257 1:82016237-82016259 CTGCTTCAATCCTGTGGCTCAGG - Intergenic
911401345 1:97379122-97379144 CTTCCTCAGTCCTGAGCCTCTGG - Intronic
911521771 1:98938339-98938361 CTGCCTGAGCCCAGGAGTTCAGG + Intronic
912437600 1:109672757-109672779 CAGCCACAGCCCTGGCTCTCAGG - Intronic
912440086 1:109691109-109691131 CAGCCACAGCCCTGGCTCTCAGG - Intronic
912756603 1:112329603-112329625 CTGCCCCAACCCTGTGGCTGCGG + Intergenic
912768005 1:112433955-112433977 CTGCCTGAGCCCAGGAGTTCGGG - Intronic
912812102 1:112802447-112802469 CGGCCTCTTCCCTGGGGCTGAGG + Intergenic
912879124 1:113390950-113390972 CCGTCTCAGCCCGGGGGCCCTGG - Exonic
915097796 1:153475951-153475973 CTGCCTCAGCCTTGGGGATTGGG - Intergenic
915268616 1:154735811-154735833 CTGCCTCAGCACAGGGCCTGAGG - Intronic
915597283 1:156902817-156902839 CTGCCTCAGCTCCTGAGCTCAGG - Intronic
915949804 1:160181583-160181605 CTGACTCAGCCCAGGGGTCCTGG + Intronic
916053329 1:161051199-161051221 AGGCCTCAGCCCTTGGGCTTTGG - Intronic
917199160 1:172497313-172497335 CTGGCGCAGCTCTGGGGCTCCGG + Intergenic
918046646 1:180945505-180945527 CCGCCCCAGCCATGGGGCTGAGG - Exonic
918649698 1:186946068-186946090 CTGTCTAAGCGCGGGGGCTCTGG - Intronic
918950172 1:191126284-191126306 CTGCTACAGCCCTTGGGCTTTGG - Intergenic
919797909 1:201332316-201332338 CTGCCTCAGCCCCTGAGGTCTGG - Exonic
919826476 1:201506960-201506982 CTGCGACAGCCCCGGGGCTGCGG + Intronic
920022558 1:202966980-202967002 ATGCCTCCGCGCTGGAGCTCGGG - Intronic
920094962 1:203480678-203480700 CTGATTCAGCCCTGGGGCTGAGG + Intronic
920250943 1:204622134-204622156 CTGACCCTGCCCTGGGCCTCTGG + Exonic
920571841 1:207023384-207023406 AGGCCTAGGCCCTGGGGCTCAGG + Exonic
920842436 1:209565959-209565981 CTGTCTCAGCCCTGCTGCTGCGG - Intergenic
922195207 1:223353722-223353744 CTTCCTCTGTCCTGGGGCACCGG - Intronic
922280934 1:224123357-224123379 CTTCCACCTCCCTGGGGCTCAGG - Intronic
922890606 1:229058865-229058887 ATGCCTCAGTCCTGGGGATGGGG + Intergenic
923048947 1:230376708-230376730 CTGCCTCAGCCCCAGACCTCGGG - Intronic
924078208 1:240363605-240363627 CAGCCTCTGTCCTGGGTCTCAGG - Intronic
1062828224 10:587654-587676 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828248 10:587746-587768 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828272 10:587838-587860 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828296 10:587930-587952 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828308 10:587976-587998 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828320 10:588022-588044 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828344 10:588114-588136 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828356 10:588160-588182 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828368 10:588206-588228 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828380 10:588252-588274 CTGCTTCAGCCCTGACCCTCCGG + Intronic
1062978899 10:1705432-1705454 CTGCTGCTGCCCTGGGGCTCCGG - Intronic
1063724214 10:8619429-8619451 CTGCTTCAGGCCTGTGCCTCAGG + Intergenic
1064215208 10:13394556-13394578 CTGCCTTGGAACTGGGGCTCTGG + Intergenic
1064960921 10:20964251-20964273 AAGCCTCAGCTCTGGGACTCTGG + Intronic
1066439371 10:35423709-35423731 CTGCCTCAGTCCTGGGTTGCTGG + Intronic
1066482419 10:35809862-35809884 CTGCGTCAGCCCCGGGAGTCAGG + Intergenic
1066505667 10:36039735-36039757 CTGCCTCAGCCATGGGGGTTGGG - Intergenic
1066656089 10:37701054-37701076 GTCCCTCAGCAGTGGGGCTCCGG - Intergenic
1066694313 10:38064361-38064383 AAGCCTCAGCCCTGGGCCCCAGG - Intronic
1066998206 10:42582815-42582837 AAGCCTCAGCCCTGGGCCCCAGG + Intronic
1067015633 10:42754949-42754971 CTGCCTGGGGCCTGGGACTCCGG - Intergenic
1067077885 10:43198353-43198375 CTGGCTGAGCCCTGGGGCCAGGG + Intronic
1067143367 10:43674931-43674953 TTGCCTCATCATTGGGGCTCTGG + Intergenic
1067227807 10:44386707-44386729 CGGCCGCAGCGCTGGGGCTCCGG + Intergenic
1067442019 10:46313959-46313981 CTGCTTAGGCCCTGGGGCCCTGG + Intronic
1067799862 10:49351505-49351527 CTGCAGCAGACCTGGGGCTGTGG - Intergenic
1067907688 10:50310781-50310803 CTGCCTCAGCCCTGAGCCCATGG + Intronic
1068116244 10:52740435-52740457 CTGCTTGAGGCCTGGGCCTCTGG - Intergenic
1068157866 10:53224012-53224034 CTGCCTCAGCCCTCTCCCTCAGG + Intergenic
1068883201 10:62072105-62072127 GTGCCTCAGAGCTGGGGTTCAGG + Intronic
1068934846 10:62625446-62625468 TTTCCTCTGACCTGGGGCTCTGG - Intronic
1069346030 10:67471031-67471053 CTCTCAAAGCCCTGGGGCTCAGG + Intronic
1069903051 10:71716940-71716962 CTGCCTCATCCCTGTGTCTGGGG + Intronic
1070283393 10:75066685-75066707 CTGCCTCGGCCCGGGGGTTTTGG - Intergenic
1070370279 10:75775936-75775958 TTGCCTCAGACCTGGGGGCCAGG + Intronic
1071309482 10:84328905-84328927 CCGCCTCAGCCCGGGAGTTCGGG - Intronic
1071347008 10:84702374-84702396 GCCCCTCAGGCCTGGGGCTCTGG + Intergenic
1071564042 10:86662478-86662500 CTCAGGCAGCCCTGGGGCTCTGG + Intronic
1073454045 10:103626028-103626050 CAGGCTCAGCCCCAGGGCTCAGG + Intronic
1074996036 10:118758423-118758445 CTGCCACAGCCCCTGGCCTCAGG + Intergenic
1075438913 10:122463955-122463977 CCTCTTCAGCCCTGGGACTCTGG - Intronic
1075439912 10:122471740-122471762 AAGGCTCAGCCCTGGGTCTCAGG - Intronic
1075451292 10:122553409-122553431 CTGCTTCATCCCTGGAGCGCAGG + Intergenic
1076249469 10:128974002-128974024 CTGTGTCAGCCCTGGTGCTGGGG - Intergenic
1076470842 10:130716903-130716925 CAGGCACAGCCATGGGGCTCCGG - Intergenic
1076672955 10:132133151-132133173 GTGCCTCAGCCCAGGGCCACGGG + Intronic
1076700616 10:132270875-132270897 CTGCTTCTGCCCTGGGCCACAGG - Intronic
1076782627 10:132732692-132732714 CCGCCCCTGCCCTGGGCCTCAGG - Intronic
1076805697 10:132857634-132857656 CTTCCTCAGCCATGGCGCCCTGG + Exonic
1077159176 11:1104924-1104946 CTGCCCCTGCCCTGGAGCTGGGG + Intergenic
1077302121 11:1852209-1852231 CTGCCTCAGCTTTTGGGGTCTGG + Intergenic
1077365421 11:2159583-2159605 CTGCCCCCACCCTGTGGCTCAGG - Intronic
1077491542 11:2863019-2863041 CTTCCTCAGCCCTGGGCCGGCGG + Intergenic
1077694723 11:4383843-4383865 AAGCCCCAGCCCTGGGGCACAGG + Intergenic
1077917862 11:6622765-6622787 CTGCCTCAGCCTTGCGGCTACGG + Exonic
1081432023 11:42986695-42986717 CTGCTGCATGCCTGGGGCTCAGG + Intergenic
1081676774 11:44974563-44974585 CTGGCTCAGCCCTGGGGAAGGGG - Intergenic
1082080804 11:48011086-48011108 CTGCCTTTGCCCAGGGGCCCTGG - Intronic
1083267097 11:61551738-61551760 CTGCCTATCTCCTGGGGCTCTGG + Intronic
1083304222 11:61754364-61754386 CTGCATCTGTCCCGGGGCTCTGG + Intronic
1083695922 11:64442337-64442359 CTGCCTCTGCCCTGGGACCTTGG + Intergenic
1083800693 11:65044746-65044768 CTGGCCCAGTCCTGGGGCTCTGG - Exonic
1084173503 11:67411598-67411620 CAGCCTCAGCCCTGGGCCGAGGG + Intronic
1084560176 11:69900627-69900649 CTTCCGCAGCCCTGGGGAGCTGG - Intergenic
1084971693 11:72775613-72775635 CTGAATCAGCCTTGGGGGTCAGG - Intronic
1085057154 11:73411712-73411734 CTCCCTCAGTCCTGGTGCACAGG + Intronic
1085239138 11:75037140-75037162 CTGCCTCAGCCTTGAGGAGCTGG - Intergenic
1085529587 11:77183591-77183613 CTGTCCCAGCCCTTGTGCTCTGG + Intronic
1086347675 11:85913788-85913810 TAGCCTCAGCCCTGTGGCACTGG - Intronic
1086697638 11:89863984-89864006 CTGCCAGGGTCCTGGGGCTCTGG - Intergenic
1086708521 11:89980504-89980526 CTGCCAGGGTCCTGGGGCTCTGG + Intergenic
1089229645 11:116961125-116961147 CTGCCACAGCCCTCAGGGTCGGG - Intronic
1089321548 11:117629924-117629946 CTGCTTGAGCCCTGGAGTTCAGG + Intronic
1089603640 11:119629269-119629291 CTGCCTCATTCCTAGGGCTCTGG - Intronic
1089713516 11:120335748-120335770 CTCCCGCAGCCCTGCGCCTCCGG + Intergenic
1090204256 11:124876099-124876121 CTGCACCAGCACTGGGGCACTGG - Exonic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1090653194 11:128824534-128824556 CGGGCTCAGCCCTGGGGGTGGGG + Intergenic
1090975715 11:131678324-131678346 GTGGCTCAGCCCTCTGGCTCTGG + Intronic
1091122147 11:133065370-133065392 GTGCCTCTGCCCTGGAGCACAGG - Intronic
1091317308 11:134623718-134623740 CTACCACAGCCCTAGGGCTTGGG - Intergenic
1091582728 12:1798910-1798932 CTTCCTCTGCCCCTGGGCTCAGG - Intronic
1091981007 12:4863972-4863994 TTGCTTCATCCCTGGGGCTCTGG - Intergenic
1094130025 12:27064598-27064620 TGACCTCTGCCCTGGGGCTCAGG + Intronic
1094179484 12:27576594-27576616 TGACCTCTGCCCTGGGGCTCAGG + Intronic
1096079992 12:48826884-48826906 CTGCCGCAGCCCTGGGGGAGTGG - Intronic
1096181260 12:49551787-49551809 CTGCTGAAGCCCTGGGGCTGAGG + Intronic
1096230567 12:49894567-49894589 CTGCCCAGGCCCTGGGGCTGGGG - Intronic
1096490189 12:52008809-52008831 CTGCCTCAGCTTTGGGAGTCTGG + Intronic
1096617894 12:52844579-52844601 CAGCCTCAGCCTTGCTGCTCCGG + Exonic
1096889202 12:54749634-54749656 CTGCCTCAGACCCTGGGCACTGG + Intergenic
1097038917 12:56142690-56142712 CTGCCGGAGCTCTGGGGCTGAGG - Exonic
1098024668 12:66189267-66189289 CCGCCTCGTCCCCGGGGCTCGGG + Exonic
1099520127 12:83650152-83650174 CTGCAGGAGCCCTGGGGCTTAGG + Intergenic
1100540466 12:95552658-95552680 ATACCTAAACCCTGGGGCTCAGG - Intergenic
1101757420 12:107631844-107631866 CTGCCTCAGCCAGGTGGCTCAGG - Intronic
1101997208 12:109533852-109533874 CTGCCTCAGATCTGGAGCCCTGG - Intronic
1102058451 12:109914325-109914347 CAGCCTCATCCTTGGGCCTCAGG - Intronic
1102534466 12:113570175-113570197 CTGCCTCAGGCCTCGGGCAGGGG + Intergenic
1102720634 12:115013290-115013312 CGGCCCCAGCCCAGGGTCTCTGG + Intergenic
1102955341 12:117055032-117055054 GTGCCTCAGCTCTGGGACACTGG + Intronic
1102997380 12:117360959-117360981 CGGCCTCAGGCCGGGGGCTCCGG - Intronic
1103321221 12:120093775-120093797 CTTCTTCCTCCCTGGGGCTCGGG - Exonic
1103333781 12:120173780-120173802 CTGTCTCAGTCCTGGCTCTCTGG - Exonic
1103367418 12:120393428-120393450 CTGCCACAGAGTTGGGGCTCAGG - Intergenic
1103536820 12:121639000-121639022 GTGTGTCAGCCCTGGGGCTGGGG + Intronic
1103719507 12:122965899-122965921 CTGCCAAAGCCCTGGTGCTCAGG + Intronic
1103905859 12:124326916-124326938 CTGTCTCAGCCCTGGGAGTCAGG - Intronic
1103964458 12:124629807-124629829 CTGCCTCAGCATGGTGGCTCTGG + Intergenic
1104242122 12:127000244-127000266 CTGACTCTACCCTGGGGCTCTGG + Intergenic
1104343156 12:127970675-127970697 CTGCGTAAGGCCTGGGGCTCTGG - Intergenic
1104595160 12:130115741-130115763 CAGCCTCAACCCTGCAGCTCTGG - Intergenic
1104747504 12:131219556-131219578 CAGCCACAGCCTTGGGGCTGGGG + Intergenic
1104757266 12:131277032-131277054 CTGGCTCAGCCCGGGGACTTGGG + Intergenic
1104811126 12:131621041-131621063 TGGCCTCAGCCCTGGGGCTCTGG - Intergenic
1104936185 12:132365618-132365640 AAGCCTCAGCCCTGGGTTTCTGG + Intergenic
1104936272 12:132366031-132366053 AAGCCTCAGCCCTGGGTTTCTGG + Intergenic
1104980262 12:132570409-132570431 CTACCTCACACCTGGCGCTCCGG + Exonic
1105333362 13:19439130-19439152 CTCCCTCAGCCCTAGGGGTAGGG - Intronic
1105657104 13:22453577-22453599 CTACCTCAGCCCTGTGGCCAAGG + Intergenic
1105878354 13:24580662-24580684 CTCCCTCAGCCCTAGGGGTAGGG + Intergenic
1105921500 13:24968412-24968434 CTCCCTCAGCCCTAGGGGTAGGG - Intergenic
1106098877 13:26676742-26676764 CTCCCTCAGCCCTGATGCTTGGG + Intronic
1106170064 13:27280955-27280977 CTCCCACAGCCCTGGGACACGGG - Intergenic
1106484516 13:30160471-30160493 CAGCCCCAGCTCTGGGGCCCAGG + Intergenic
1106487031 13:30181160-30181182 CTGCCTGAGCCCATGGGTTCAGG + Intergenic
1106555584 13:30805702-30805724 CCGCTCCAGCCCTGAGGCTCCGG + Intergenic
1106776659 13:33016278-33016300 CTGCCTCCGCCCTGGCACTGGGG - Intergenic
1107175661 13:37395302-37395324 CTGCCCCAGTCTGGGGGCTCTGG - Intergenic
1107467984 13:40666455-40666477 CTGCCCCGGCCCGGCGGCTCTGG - Exonic
1108716299 13:53081402-53081424 CTGCTTCAGCTCTGGCTCTCTGG + Intergenic
1110331491 13:74278222-74278244 CTACCTCAGCCCTAGGAATCTGG + Intergenic
1111913000 13:94332554-94332576 CTGGCTCAGCCGTTGGTCTCTGG + Intronic
1112114311 13:96335489-96335511 CTTTCTCATCCCTGTGGCTCTGG + Intronic
1114288673 14:21269886-21269908 CTGCCCCAGCCCCGGGCCTAGGG + Intergenic
1115320777 14:32077210-32077232 CTGCGGGAGCCGTGGGGCTCAGG + Intronic
1118720717 14:68591816-68591838 CTTCCACATCCCAGGGGCTCAGG - Intronic
1119090055 14:71772975-71772997 CCACCTCAGGCCTGAGGCTCAGG + Intergenic
1119435387 14:74594896-74594918 CTCCCACAGCCTGGGGGCTCGGG - Intronic
1119789877 14:77340596-77340618 CTGTGTCACCCCTGAGGCTCAGG - Exonic
1120993594 14:90398259-90398281 TGGCCTCAGCCCTGGTGCGCGGG + Intronic
1121004895 14:90483858-90483880 TTGCGTCATCCCTTGGGCTCTGG + Intergenic
1121433445 14:93903341-93903363 CAGCATCAGCCCCGGGGGTCTGG - Intergenic
1121635574 14:95451834-95451856 GTGCCTGAGCCCGGGGGCTGAGG + Intronic
1121635576 14:95451837-95451859 GTCCCTCAGCCCCCGGGCTCAGG - Intronic
1121648356 14:95536132-95536154 CTGGCTCAGCCTTGGAGCCCAGG + Intronic
1121926348 14:97930532-97930554 CTGGCTCAACCCTGAGGCCCAGG - Intronic
1122687906 14:103518697-103518719 CTGCCCCACCCCTGGGGATCAGG - Intergenic
1122848676 14:104514712-104514734 GTGGCCCAGCCCTGGGGCCCCGG - Intronic
1122971142 14:105152703-105152725 CTGCCTCGGCCATGTGGCCCTGG + Intronic
1123019238 14:105389855-105389877 CTGGCGCAGCCCTGGGGCCGCGG - Intronic
1123053495 14:105559025-105559047 CTTCCTCCTCTCTGGGGCTCTGG + Intergenic
1123078072 14:105679439-105679461 CTTCCTCCTCTCTGGGGCTCTGG + Intergenic
1123108530 14:105854533-105854555 CGGCCTGGGGCCTGGGGCTCAGG + Intergenic
1123151404 14:106185257-106185279 CTCTCTCAGCCCTGGGACTGGGG + Intergenic
1123171560 14:106377655-106377677 CTTCCTCAGCCCTGAGACTGGGG + Intergenic
1123195269 14:106610118-106610140 CTCCCTCAGCCCTGGGACTGGGG + Intergenic
1123223127 14:106874939-106874961 CTTCCTCAGCCCTGAGACTGGGG + Intergenic
1123399803 15:19973140-19973162 CTCCCTCAGCCCTGGGACTGGGG + Intergenic
1124034199 15:26039022-26039044 CTGCCTCAGCCTTGTGGGCCTGG - Intergenic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1125720125 15:41841355-41841377 CTGCCTCAGCCTGGGGACCCTGG + Intronic
1125922531 15:43533934-43533956 CTGCCTCAGTCCTGTTCCTCTGG - Exonic
1127425872 15:58855805-58855827 CTGCCTCAGCCCTGAGTAGCTGG - Exonic
1127849037 15:62897143-62897165 ATGACTCAGCCTTGGGGCCCCGG + Intergenic
1128614815 15:69100831-69100853 CTGCCTAAGTCCAGGGGCTGAGG + Intergenic
1129663246 15:77565042-77565064 CGGCCTCAGCCCAGAGCCTCTGG + Intergenic
1129811083 15:78510526-78510548 CTGCCTCAGTCCTAGGACTATGG - Intronic
1130103573 15:80912363-80912385 CTCCCTCCGGCCTGGGTCTCAGG + Intronic
1130542931 15:84835023-84835045 AGGCCCCAGCCCTGGGGCTGTGG + Intronic
1130765520 15:86866737-86866759 CTGCCTCAGCCCTGAGTAGCTGG - Intronic
1131173592 15:90195827-90195849 CTGCCTGAGCTCAGGGGTTCGGG - Intronic
1131683786 15:94750557-94750579 CTGCCTCACCCCTGGCTTTCTGG + Intergenic
1132215929 15:100061668-100061690 CTGGCTCAGCCCTGAGTGTCTGG - Intronic
1132331529 15:101015380-101015402 CTGCCTCAGTCCCGGAGCGCTGG - Exonic
1132357094 15:101179780-101179802 CTGCCTCCGCCCCGTGGCGCAGG + Intronic
1132662643 16:1068479-1068501 CTGCTTTAGGGCTGGGGCTCGGG - Intergenic
1132734530 16:1379038-1379060 CTGCCTCAGCCCCGGGCGTTAGG + Intronic
1133202887 16:4215239-4215261 CTGCCTCAGCCCCTGCACTCTGG - Intronic
1133812243 16:9169800-9169822 CTGCACCAGCCCAGGGGCTGAGG - Intergenic
1134556280 16:15168135-15168157 CTGCCTCAGCCCTGAGTAGCTGG - Intergenic
1137275678 16:46931905-46931927 CAGCCTCTTCCCTGGGGCTGGGG + Intergenic
1137468460 16:48732783-48732805 CTGCCACAGCCCAGGGGCAGAGG - Intergenic
1138189571 16:55003481-55003503 GTGGCCCAGCCCTGGGCCTCTGG + Intergenic
1138337133 16:56262045-56262067 CTCACTCAGCCCTGGGACTTAGG + Intronic
1138366377 16:56481294-56481316 CTGGCTCAGCACTGGGGCGAGGG + Intronic
1139504529 16:67392385-67392407 CACCCGCAGCCCTGGGGCTGAGG + Intronic
1139521077 16:67483097-67483119 CTGCCCCAGGCCTGGGCCTGCGG - Exonic
1139666407 16:68459853-68459875 GTCCATCAGCCCTGGGGCTGAGG + Intergenic
1139712827 16:68789698-68789720 CTGCCCCAGCCCTGGACATCTGG + Intronic
1141480315 16:84301958-84301980 CTGCCTCTGCCCTGTGGCTGCGG - Intronic
1141574550 16:84955594-84955616 CTGCCTGGGCACTGGGGATCAGG + Intergenic
1141636731 16:85317897-85317919 CTGCCTCAGCCCGGGGTTCCTGG + Intergenic
1141979226 16:87539504-87539526 CTGCTTGAGCCCAGGGGCTTGGG - Intergenic
1142027135 16:87820465-87820487 CTGCCCCATCCCAGGGACTCAGG + Intergenic
1142255047 16:89009677-89009699 CTGGCTCATTCGTGGGGCTCAGG - Intergenic
1142411235 16:89918237-89918259 CAGCTGCAGCCCTGGGGCTGTGG - Exonic
1142621162 17:1166486-1166508 CTGCCACACCCCCGGGCCTCCGG - Intronic
1142717666 17:1755771-1755793 CTGCCCCAGCTCCTGGGCTCTGG - Intergenic
1142746766 17:1963304-1963326 CTGACCCAGCCCCGTGGCTCTGG + Intronic
1142856185 17:2731600-2731622 CTGGCAAAGCCCTGGGTCTCTGG - Intergenic
1142879643 17:2874421-2874443 CTCCGTCAGCCCGGGGCCTCAGG - Intronic
1143370222 17:6434874-6434896 CAGCCCCAGCGCTGGGCCTCCGG - Intronic
1143405486 17:6674791-6674813 CGACCTGAGCCCTGGGCCTCGGG + Intergenic
1143405490 17:6674801-6674823 CTGGCTCAGCCCCGAGGCCCAGG - Intergenic
1143512875 17:7405588-7405610 CTGGCTCAGCCCTGGGGCCGTGG - Intronic
1143641998 17:8204490-8204512 CTCCCACAGCCCAGGGGCACTGG - Intergenic
1144489976 17:15700138-15700160 CTGCCTCAGTCCTACGGCGCTGG - Exonic
1144560596 17:16317683-16317705 CTCCCTCTACCCTGTGGCTCAGG - Intronic
1144638932 17:16927098-16927120 CGGCCTCAGCCCTGGGGAGGAGG + Intergenic
1144697287 17:17313618-17313640 CAGCCTCATCCCAGGGGCTGCGG + Intronic
1144846840 17:18224684-18224706 CTGGCTCAGGGCTGGGGCTGCGG - Intergenic
1144854212 17:18258947-18258969 CGGCCCCTGCCCTGGGGCGCTGG - Intergenic
1144910985 17:18681821-18681843 CTGCCTCAGTCCTACGGCGCTGG + Exonic
1145269276 17:21396083-21396105 CTGCCTGCGCCCGGGGGCCCAGG - Intronic
1145905400 17:28513650-28513672 CCGCCTCAGCCCTCGGGCAGGGG + Intronic
1146132682 17:30292117-30292139 CGGCCTCAGCCCCCGGGCGCTGG - Intergenic
1146257327 17:31399071-31399093 CTGCCTCAGCCCTGGAGTGTAGG + Intronic
1146269012 17:31472333-31472355 CTGGTTCTGCCCTGGGGGTCGGG + Intronic
1146277685 17:31525569-31525591 TTACCTTGGCCCTGGGGCTCTGG - Intronic
1146278659 17:31531148-31531170 CTGCCTCTGCCCAGGGGTTGGGG - Intronic
1146501967 17:33372405-33372427 CTGCCTACCCCCTGGGGCCCGGG + Intronic
1147340776 17:39752157-39752179 CTGCCAGAACCCTTGGGCTCTGG - Intergenic
1147442137 17:40453804-40453826 CTGCCCAGCCCCTGGGGCTCAGG + Intronic
1147446795 17:40479643-40479665 CTTCCCTTGCCCTGGGGCTCCGG - Intronic
1147525074 17:41214838-41214860 CTGCCTCTGTCCTGGGACTTTGG + Intronic
1148397734 17:47323820-47323842 CCGCCACCGCCCAGGGGCTCCGG - Intronic
1148587596 17:48791805-48791827 CTGCACCCACCCTGGGGCTCTGG - Intronic
1149459362 17:56814518-56814540 CTGCCTCTTCCCTTGGGCCCCGG - Intronic
1149835233 17:59906475-59906497 CTGCCTCAGCCCTGAGTAGCTGG + Intronic
1150128182 17:62652423-62652445 CTGCCTCCGCCCCCGCGCTCCGG + Intronic
1150131305 17:62670686-62670708 ATTTCTCAGCCCTGGGGTTCAGG + Intronic
1150215172 17:63463778-63463800 GTGACTCAGCCTTGGGGGTCTGG + Intergenic
1150292650 17:63990543-63990565 CTCCCTCCACTCTGGGGCTCTGG + Intergenic
1150419916 17:65024169-65024191 CAGCCTCAACCCCCGGGCTCAGG - Intronic
1150631821 17:66885308-66885330 CAACCACAGGCCTGGGGCTCAGG - Exonic
1151459964 17:74248635-74248657 CTGCAGCTGCCCTGGGGCCCAGG + Intronic
1151891938 17:76956252-76956274 TTGCTTCAGCCCAGGGGCTGGGG - Intergenic
1152242565 17:79168011-79168033 CTCACCCAGCCCTGGGGCTGGGG - Intronic
1152259764 17:79260609-79260631 CTGGGCCACCCCTGGGGCTCTGG - Intronic
1152935758 17:83135799-83135821 CTGACTCACCCCTAGGGCTGAGG + Intergenic
1152950814 17:83229749-83229771 CTCCTTCACCCCTGGGCCTCAGG - Intergenic
1153480476 18:5543074-5543096 CTGCCGTGGCCCGGGGGCTCGGG - Intronic
1154270075 18:12911440-12911462 CTGCCGCCGCTCTGGGCCTCCGG - Intronic
1155233098 18:23793412-23793434 CTGCTTCAGCCCCTGGGCTTTGG - Intronic
1155474730 18:26226635-26226657 CTGCCTCAGCCCTGCGCCTCAGG - Exonic
1156487862 18:37477973-37477995 CAGCCCCAGCCCTGGGGAGCAGG + Intronic
1157498398 18:48172410-48172432 CTGCTTCAGGCCTGCAGCTCCGG - Intronic
1157521328 18:48347558-48347580 CTGCCTCTGCCTTGGGCCCCTGG + Intronic
1158516206 18:58132117-58132139 ATCCCTCAGCCCTGGGTCTGTGG - Intronic
1160266289 18:77342790-77342812 CTGACCCAGCCCTGGGACCCTGG - Intergenic
1160402326 18:78620124-78620146 CTGCCTGTGCCCTGGGGCCATGG + Intergenic
1160742880 19:695419-695441 CTGCGTCTGCCATGGGGCTCGGG - Exonic
1160879015 19:1311148-1311170 CTCCCTCTGCCCTGGACCTCTGG - Intergenic
1160911538 19:1476136-1476158 CTGCTTCAGCCCTGCTGCACTGG - Intronic
1160953583 19:1679302-1679324 ATGCCTCAGGCCAGGGGCTGGGG + Intergenic
1161026143 19:2038321-2038343 CTGCCCCAGCTGTGGAGCTCGGG + Exonic
1161109704 19:2462357-2462379 ATGCCCCAGACCTCGGGCTCTGG - Intergenic
1161268107 19:3374540-3374562 GTGCCTCAACTCTGGGCCTCAGG + Intronic
1161325500 19:3661835-3661857 CTGGGTGAGCCCTGAGGCTCCGG + Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1161645520 19:5451177-5451199 CTCCCTCAGCCCTGGCTGTCTGG + Intergenic
1161728211 19:5942944-5942966 CAGCCTCAGACCCCGGGCTCAGG - Intronic
1161945823 19:7435916-7435938 TTGCTTGAGCCCTGGGGTTCAGG - Intronic
1162412583 19:10515335-10515357 CTGCCTCAGGCCTGAGCCTGGGG - Intronic
1162418775 19:10553933-10553955 CTGCCTGCTCCCTGGTGCTCAGG + Exonic
1162456922 19:10790845-10790867 CAGCCTCACCACTTGGGCTCAGG + Intronic
1162502244 19:11060475-11060497 CGGCCTCAGCCCAGGAGCCCTGG - Intronic
1162768229 19:12933187-12933209 CTGACCCAGCCTTGGGGGTCAGG - Intronic
1162803188 19:13122351-13122373 CTGTCTCAGCCATGAGACTCTGG + Intronic
1162876380 19:13623883-13623905 TCGCATCAGCGCTGGGGCTCAGG + Intronic
1163060254 19:14755570-14755592 TCAGCTCAGCCCTGGGGCTCAGG - Intronic
1163365355 19:16873074-16873096 CTGTGTCCTCCCTGGGGCTCAGG + Intronic
1163470926 19:17496547-17496569 CAGGCTCAGCCAGGGGGCTCTGG + Intronic
1163697969 19:18773534-18773556 CTGGGTCTGTCCTGGGGCTCGGG - Intronic
1163716916 19:18878304-18878326 CTGCCCCAGGCCTGGGGCTTCGG + Exonic
1164628795 19:29747405-29747427 GTGCCTCATGCCTGGGCCTCAGG - Intergenic
1164739824 19:30567605-30567627 CTCCCTCAGACCTGGACCTCAGG - Intronic
1164764686 19:30755161-30755183 CTTCCTCAGCCCTCCGCCTCTGG + Intergenic
1165149432 19:33752143-33752165 CTGCCTGAGCCCGGGAGCCCTGG + Intronic
1165151580 19:33763818-33763840 GTCCCTCAGCCCTGGGGCAGTGG + Intronic
1165474960 19:36025130-36025152 CACCCCCAGCCCTGGGTCTCAGG - Intronic
1165616555 19:37206954-37206976 CTGCCTCTGCCCTAAGGCTGTGG + Intronic
1166000569 19:39875290-39875312 CTTCCTCCTCCATGGGGCTCAGG - Intronic
1166003367 19:39891545-39891567 CTTCCTCCTCCATGGGGCTCAGG - Intronic
1166291463 19:41866343-41866365 CTGGTTGTGCCCTGGGGCTCTGG - Intronic
1167334429 19:48875763-48875785 CTGCCTCACCCCTGCTGCCCGGG + Exonic
1167510890 19:49894895-49894917 CAGCGCCAGCCCTGGGCCTCTGG - Intronic
1167880927 19:52456688-52456710 CTGCATCATCCCTGGTGCTGTGG + Intronic
1168076695 19:53984255-53984277 CTGTTTCACCCCTGGGGATCTGG - Exonic
1168136913 19:54357751-54357773 CTGCCTCAGCCCCGGGGGAGGGG - Intronic
1168180933 19:54662831-54662853 CTGCCTCAGCCCTAGCTCTGGGG + Exonic
1168291761 19:55360646-55360668 CTCCCTCAGCTCTGGGGCCTGGG + Intronic
1168294135 19:55370440-55370462 CTGCCGCGGCCCTGCTGCTCAGG - Intronic
1168345593 19:55648856-55648878 TTGCCTCAGTCCTGGGGTCCAGG + Exonic
925128928 2:1480946-1480968 CTCCCTCAGCCCTGGGCCACAGG + Intronic
925200568 2:1965099-1965121 CTGCCTGATCCCTGGGTCTTGGG - Intronic
925241172 2:2330886-2330908 CAGCCTCAGCCCTTGAGCTACGG + Intronic
925255564 2:2483910-2483932 CTCCCTCAGCCATTGTGCTCAGG + Intergenic
925941033 2:8819387-8819409 CTCCCTCAGCCCTGGAGATGAGG + Intronic
925979273 2:9164081-9164103 CTGCCCCTGCCCCGGGGCACTGG - Intergenic
926272474 2:11377080-11377102 CTGCCTCTCCCCAGAGGCTCTGG - Intergenic
926361902 2:12096560-12096582 CTGTCTCAGCTATGGGGCTCTGG - Intergenic
926373297 2:12202422-12202444 CTCCTGCAGCCCTGGAGCTCAGG + Intergenic
926433789 2:12817663-12817685 CTGCCTCAGCCCTGTGTGTAAGG - Intergenic
926740002 2:16102954-16102976 ATGCCTCGGCCCCTGGGCTCAGG - Intergenic
927206827 2:20616380-20616402 CAGCTTCAGCCCTGGGACCCAGG - Intronic
927222772 2:20729510-20729532 TGTCCTCAGCCCTGGGACTCTGG + Intronic
927702634 2:25277506-25277528 CTGTGTCAGCCCTGCGGCTAGGG + Intronic
927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG + Intergenic
928928098 2:36598255-36598277 CTGTCCCAACCCTGGGTCTCCGG + Intronic
929762023 2:44814757-44814779 CAGCCTCAGCCCTGGTGTTTGGG - Intergenic
929783156 2:44970865-44970887 CTGCCTTTGACCTGGGGATCAGG + Intergenic
929995669 2:46824997-46825019 CTGACTCAGTACTGGGGGTCAGG - Intronic
930057771 2:47265129-47265151 CTACCTGGGCCCTGAGGCTCTGG + Intergenic
930891919 2:56400228-56400250 CTGCCACAGCCCAGGGGCTCAGG - Intergenic
930991016 2:57654971-57654993 CTGCCTCAGCCCATGGCTTCAGG + Intergenic
931601203 2:64004995-64005017 CTGCCTGAGCCCAGGAGTTCAGG - Intronic
931653651 2:64490664-64490686 CTGCCGTATCCCTGGGGCACTGG - Intergenic
932762178 2:74445408-74445430 CTGCCTCCTTCCTGGGTCTCAGG - Intergenic
933727567 2:85435425-85435447 CTGACTCAGCCTTGGTACTCGGG + Exonic
933766726 2:85714263-85714285 CTGCCTGAGCTCTGGGGTCCAGG + Intergenic
933812706 2:86042976-86042998 TGGCCGCAGCCCTGGGACTCAGG - Exonic
934131696 2:88954948-88954970 GGTCCTCAGCCCTGTGGCTCAGG - Intergenic
934474807 2:94586945-94586967 CTTCCCCAGGGCTGGGGCTCAGG + Intergenic
934567551 2:95348918-95348940 CTGCCACAGCCCTAGGGAGCAGG - Intronic
936047220 2:109197155-109197177 CTGCTGCAGCCCTGCGGCCCAGG + Intronic
937296934 2:120815081-120815103 CAGGCTCATCCCTGGGGCTCAGG - Intronic
937319381 2:120951884-120951906 CAGCCCAGGCCCTGGGGCTCCGG + Intronic
937363088 2:121242552-121242574 CTCCCTGCGCCCTGGGGCCCTGG - Intronic
937830950 2:126422565-126422587 CTGCCTCAGCCCTTGAGTGCTGG - Intergenic
938293463 2:130162468-130162490 CTGTGCCAGACCTGGGGCTCAGG + Intronic
938383659 2:130850185-130850207 CTGCCCCCTCCCTGGGGCACTGG - Intronic
938463090 2:131510493-131510515 CTGTGCCAGACCTGGGGCTCAGG - Intergenic
938950750 2:136252256-136252278 TTGCTCCAGCCCTGGGTCTCTGG + Intergenic
939961306 2:148568418-148568440 CTGCTTCAGCCCTGTGGCTTCGG - Intergenic
940036897 2:149320733-149320755 CCCCCGCGGCCCTGGGGCTCAGG - Intergenic
940038070 2:149330598-149330620 CTGCCGGAGCCCGGGAGCTCAGG - Exonic
940185322 2:150978114-150978136 CTTCCTCAGCCCTAGGCATCTGG - Intergenic
941686182 2:168451386-168451408 CTGCCTGAGCCCAGGAGTTCTGG + Intergenic
941924931 2:170885261-170885283 CAGCCTCACCACTTGGGCTCAGG - Intergenic
942117645 2:172743784-172743806 CTGCCACAGGCCCGGGCCTCGGG - Intronic
942446170 2:176080302-176080324 CTGCCGCAGCCCTGGGTTCCCGG - Exonic
942799808 2:179861710-179861732 GGTCCTCAGCCCGGGGGCTCGGG + Intergenic
944079353 2:195769583-195769605 ATGCATCAGCCCTGGGTCTAGGG + Intronic
944543266 2:200774615-200774637 CTGCCTCAACTCTGGGCCGCAGG + Intergenic
946225469 2:218261957-218261979 CAGCCTCAGGCCTGGGGGTGTGG + Intronic
946339366 2:219058176-219058198 AGGCCTCAGCCCTGAGGCTGCGG - Intronic
946495353 2:220191045-220191067 CAGCCTCAGCCCTGTAGCTCTGG - Intergenic
947813031 2:233016088-233016110 TTCCCTCAGCCCTGGGCCTGGGG - Intergenic
947865322 2:233393794-233393816 CTGCCTCAGCCTTGGGTAGCTGG + Intronic
948005353 2:234603755-234603777 CTGCCCCAGCTCTGAGGCTTGGG + Intergenic
948127592 2:235576172-235576194 CTGGCGCAACCCTGGGCCTCAGG + Intronic
948644238 2:239393681-239393703 CAGCCACAGCCCTGGTTCTCAGG + Intronic
948853168 2:240718227-240718249 CTGCCTGGGCCCTGGGGAGCAGG - Intronic
948955457 2:241286866-241286888 CTGCTCAACCCCTGGGGCTCAGG - Intronic
1168733036 20:103787-103809 GTGCTGCAGCCCTGGGGCACGGG - Intergenic
1169074533 20:2752659-2752681 CTGGCTCAGCCCTCGGGGTCAGG + Intronic
1169103031 20:2968797-2968819 CTGCCTCAGCCCTGAGTAGCTGG - Intronic
1169207897 20:3750234-3750256 CTGCCTGAGCCCGCGGGCTCAGG - Intronic
1169252204 20:4069329-4069351 CAGCCTCAGCTCTAGGGTTCAGG + Intergenic
1169292560 20:4365175-4365197 CTTCCTCAGCCCCAGGACTCTGG + Intergenic
1169515263 20:6309984-6310006 CTTGCTCAGCCCTGTGGCTTTGG + Intergenic
1169640935 20:7751413-7751435 TTGCCTCAGCCCTGCAACTCAGG - Intergenic
1172175682 20:32970627-32970649 CAGCCTCAAGCCAGGGGCTCAGG - Intergenic
1172216931 20:33242295-33242317 CTGCCTCAGCCCTGACACTGAGG + Intronic
1172811302 20:37650087-37650109 CCCCCCAAGCCCTGGGGCTCAGG - Intergenic
1173166505 20:40690026-40690048 CGGCCTCGGCCCCGAGGCTCCGG - Intergenic
1173281826 20:41635224-41635246 CTCCCTCTGCCCTGCTGCTCAGG - Intergenic
1173403929 20:42748693-42748715 CTGCCAAAGCCCTGGGGAGCGGG + Intronic
1173458526 20:43223227-43223249 ATGCCTTAGACCAGGGGCTCTGG - Intergenic
1173648734 20:44650086-44650108 CTCCCTCTGCCCTTGGGCTGGGG - Intronic
1173840556 20:46154079-46154101 CTCCCGCTGCCTTGGGGCTCAGG + Intergenic
1174033645 20:47651775-47651797 CTGCCTCAGCCCTGAGTAGCTGG + Intronic
1174112277 20:48205023-48205045 TGGCCTCAGACCTGGGGGTCTGG + Intergenic
1174388401 20:50200795-50200817 CTGCCCTAGCCCTGGAGCCCTGG + Intergenic
1175257860 20:57657775-57657797 TTGGCTCAGCCCAGGGACTCTGG + Intronic
1175323176 20:58103708-58103730 CTCCTTCTGCCCTGGGGCTGAGG + Intergenic
1175447760 20:59036146-59036168 CTTCCTCAGTGCTGGGCCTCAGG + Intronic
1175799299 20:61792072-61792094 CTCTCTCCTCCCTGGGGCTCTGG - Intronic
1175927067 20:62476097-62476119 CAGGGTCAGCGCTGGGGCTCCGG + Intergenic
1176146083 20:63566160-63566182 CCTGCTCAGCCCTGGGGCACTGG - Exonic
1176382597 21:6120726-6120748 CTGCCCCCGCCCTGGGACCCCGG + Intronic
1176739680 21:10589463-10589485 CTCCCTCAGCCCTAGGGGTAGGG + Intronic
1178457734 21:32771443-32771465 CGGCCTCAGCCCCGAGGCCCGGG + Exonic
1178738215 21:35171848-35171870 CTGCCTCTGGCCTGTGGCACTGG - Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179170093 21:38966276-38966298 CTGCCTCAGCCTGGAGGCGCAGG - Intergenic
1179314883 21:40234846-40234868 CTGCCTCTACCCTGGGCTTCGGG - Intronic
1179657289 21:42853206-42853228 CAGCCTCGGGCCTGGGGCACTGG - Intronic
1179659405 21:42864916-42864938 CTGCCACAGCCCTGGGGGTGGGG - Intronic
1179740872 21:43417513-43417535 CTGCCCCCGCCCTGGGACCCCGG - Intronic
1180017852 21:45098905-45098927 CTGCCTCAGAATTGGGGGTCAGG + Intronic
1180693268 22:17735855-17735877 CTGCCTCAGCCCTCAGTCTCTGG + Intronic
1181054248 22:20252657-20252679 CTGTGTCATCCCTGGGGCTCAGG - Intronic
1181057390 22:20266643-20266665 CTGCCTCAGCCCTGGTGGGTAGG + Intronic
1181171298 22:21011668-21011690 CTGCCTCAGACCTGGAGGTTTGG - Intronic
1181472561 22:23149878-23149900 TTTCCTCAGCCTTGAGGCTCTGG - Intronic
1181810754 22:25402657-25402679 CTGCTGCAGCCCTGGGGGGCAGG - Intronic
1182273670 22:29171540-29171562 CAGCGTCACCCCTGGGCCTCTGG + Intergenic
1182443368 22:30376746-30376768 CAGCCTCAGCCCTGGGCCACAGG - Exonic
1182470763 22:30546837-30546859 GTGCCTCAGGCATGGGGCCCTGG + Intergenic
1182483754 22:30626900-30626922 CCTCCTCAGCCCGGGGGCTATGG + Exonic
1182622580 22:31626140-31626162 CTGGCTCAGCCCTGGGTAGCAGG - Intronic
1182718319 22:32377643-32377665 GTGCCTCATCCCTGGGTCACGGG - Intronic
1183597924 22:38823306-38823328 CTGCCTCAGCCATGGGCCTTGGG - Intronic
1183831138 22:40418892-40418914 TTGCCTGAGCCCTGGGGGGCGGG - Exonic
1183933348 22:41248490-41248512 CTGCCTCAGCTGGTGGGCTCTGG + Intronic
1184037757 22:41926562-41926584 CTGCCTGCGCCCTGGCGATCGGG + Intronic
1184176750 22:42793373-42793395 CTTCCTGATCCCTGAGGCTCTGG + Intergenic
1184199432 22:42956343-42956365 CTCCTCCAGCCCTGGGGCTCTGG - Intronic
1184497042 22:44848107-44848129 CTGCCTCCGCTCTGAGGCCCCGG - Intronic
1184714522 22:46273316-46273338 CTGGCTCAGGCCTGGGACCCAGG - Intronic
1184816628 22:46876798-46876820 CTGCAGCAGCCCTGGGGGTGGGG - Intronic
1184841911 22:47057058-47057080 CTGCCTTAGCCCCGGGTCTGTGG + Intronic
1185020837 22:48373962-48373984 CTGCCTTGTTCCTGGGGCTCTGG + Intergenic
1185021578 22:48379780-48379802 CTGCTCCAGCTCTGGGGCTCTGG - Intergenic
1185115355 22:48931680-48931702 ATGCCTCAGCTCAGGGGGTCAGG + Intergenic
1185128002 22:49022447-49022469 CTGCCACTGCCGTGGGGGTCGGG - Intergenic
1185161820 22:49234594-49234616 CTCCCTCAGGCCTGGGGAGCAGG + Intergenic
1185227057 22:49659260-49659282 CTCCCTCAGTCCCGGGGCACCGG + Intergenic
1185350837 22:50336789-50336811 TTGCCTGAGCCCTGGAGGTCGGG - Intergenic
949934800 3:9108358-9108380 CTCCCAAAGCCCTGGGACTCAGG - Intronic
950992886 3:17459676-17459698 CTGCCTGAGCCCAGGAGTTCAGG + Intronic
952339796 3:32436085-32436107 CTGCCCAAGGCCTGGAGCTCAGG + Intronic
952904483 3:38130811-38130833 CTGCCACAGCCCTGGGACAGGGG + Intronic
953211446 3:40878574-40878596 TTCTCTGAGCCCTGGGGCTCTGG - Intergenic
953740172 3:45531601-45531623 CTGCTTGAGCCCAGGAGCTCAGG - Intronic
954129140 3:48550910-48550932 CTGGCACAGCGCTGGTGCTCAGG + Intronic
954375053 3:50189702-50189724 CTGCCTCAGCTTAGGGGGTCTGG - Intergenic
954643278 3:52115007-52115029 CTGCCCGTGCCCTTGGGCTCAGG - Intronic
954692382 3:52402457-52402479 CTGCCTCAGGCCAGGAGCTGAGG + Intronic
955329600 3:58036171-58036193 CTTCGTCAGCTCTGGGGCTTTGG + Intronic
956718393 3:72098215-72098237 CTGCCTGAGCCATGGTGCTGAGG + Intergenic
956718394 3:72098218-72098240 CTGCCTCAGCACCATGGCTCAGG - Intergenic
956927769 3:74007979-74008001 CTGCCTGAACCCTGAGGCTGAGG - Intergenic
957223389 3:77412797-77412819 TAGCCTCTGCCCTGGGGCACTGG + Intronic
957362915 3:79182521-79182543 CTTCATCAGCACTGGGGCACAGG + Intronic
960036190 3:113105174-113105196 CAGCTTCAGCCCAGGGGCTCTGG - Intergenic
961321809 3:126082270-126082292 TTGGCTCCTCCCTGGGGCTCTGG - Intronic
961452111 3:127006898-127006920 CTGCCTCAGCCTGGGTCCTCTGG - Intronic
961455196 3:127020547-127020569 CTGCCCCAACCCCAGGGCTCAGG - Intronic
961479975 3:127173379-127173401 CTGCCACAGCCCTGGGTGTCTGG - Intergenic
961481268 3:127182705-127182727 CTGCCTCAGCCCTTGCCGTCGGG - Intergenic
961485551 3:127213401-127213423 CTGCCTCTTTCCTGGGGCTTTGG - Intergenic
961596578 3:128022626-128022648 CAGCCCCAGCCCTGGCCCTCAGG + Intergenic
961819953 3:129570976-129570998 CAGCCTCAGCTGTGGGCCTCGGG - Intronic
962118757 3:132540301-132540323 CTGGCTCCTCCCTGGGTCTCAGG - Intergenic
962209677 3:133466920-133466942 CTGTCTCAGCCTGGAGGCTCTGG - Exonic
962251094 3:133836589-133836611 CTGCCTCAGCCGTCAGGGTCAGG - Intronic
962267764 3:133955616-133955638 TGTGCTCAGCCCTGGGGCTCTGG + Intronic
962321648 3:134395640-134395662 CTGCCTCAATCATGGGGCTCAGG + Intergenic
962350107 3:134650473-134650495 ATGAGTCAGCCCTGAGGCTCTGG + Intronic
962710713 3:138083438-138083460 TTTCCACAGACCTGGGGCTCTGG + Intronic
962746675 3:138402079-138402101 CTGACTCAGATCTGGGGCTAGGG + Intronic
962950333 3:140212811-140212833 AGGCCTCAGCCCTCAGGCTCTGG + Intronic
963873923 3:150451940-150451962 CTGCTTGAGCCCAGGAGCTCAGG - Intronic
963929773 3:150991725-150991747 GTGCCTCAGCCCAGGCACTCAGG + Intergenic
965545158 3:169908414-169908436 CTGCCTCAGGCTGGAGGCTCTGG - Intergenic
966488926 3:180504460-180504482 CTGCTTCAGCCCAGGAGTTCAGG - Intergenic
966863807 3:184245213-184245235 CTGGCCCAGCGCTGGGGCTGGGG - Exonic
966888354 3:184388929-184388951 CTGCCACTGTCCTGTGGCTCGGG + Exonic
967544973 3:190714828-190714850 CCACCTCAGCCTTGGGGTTCTGG - Intergenic
967850095 3:194075891-194075913 CTGCCTCAGCACATGGGTTCAGG + Intergenic
968278573 3:197458906-197458928 GTGCCTCAGCCGTGGCCCTCTGG + Intergenic
968756407 4:2418420-2418442 CTGCGACAGCGCGGGGGCTCCGG - Exonic
968783009 4:2597460-2597482 CTGCCTCTGCCCTTGGGAACAGG + Intronic
968814014 4:2812488-2812510 CGGCCCCAGGACTGGGGCTCGGG + Intronic
968904770 4:3446104-3446126 CTGCCGCAGGCCTGGCGCCCCGG - Exonic
968987064 4:3881206-3881228 CTGCCTGAGTCCTGGAGCCCCGG + Intergenic
969105538 4:4804678-4804700 CCTCCACAGCTCTGGGGCTCAGG + Intergenic
969841399 4:9885435-9885457 CTGCCTCTTCCCTGGAGCTCAGG + Intronic
971230467 4:24796985-24797007 CTGCCTACTCCCTGGGGCTTTGG + Intronic
971953961 4:33392057-33392079 CTGCCTCAGCCCTGAGTAGCTGG + Intergenic
972646856 4:40976686-40976708 CAGACACAGCACTGGGGCTCAGG + Intronic
973337343 4:48970143-48970165 CTGCCTGAGCCCAGGAGTTCAGG - Intergenic
975738137 4:77401614-77401636 CTCCCTCACCACTGGGACTCAGG - Intronic
976322889 4:83735874-83735896 CTGCCTCAGCCTTGAGCCTCTGG - Intergenic
976492984 4:85693510-85693532 ATGCTACAGCCCTGGGGCACAGG + Intronic
981972002 4:150674788-150674810 CTGCTTGAGCCCTGGAGGTCAGG + Intronic
982158031 4:152540458-152540480 CTGACTGAGCCCCGGGCCTCAGG + Intergenic
985564778 5:610038-610060 CTGCCACAGCCCTTAGGCTGTGG - Intergenic
985589510 5:757300-757322 CTTCCTCACCCCTGGGGCCAAGG - Intronic
985754289 5:1703931-1703953 CGGCCACAGCACTGGGGCTTCGG - Intergenic
985793768 5:1947090-1947112 CTGCCTCCTCCCAGGGGCTCTGG + Intergenic
985834873 5:2262858-2262880 CTGCCCCTGCCCTTGGGGTCGGG - Intergenic
985866614 5:2519246-2519268 AAGCCTCAGCCCTGGGTCCCTGG + Intergenic
987065686 5:14287415-14287437 TTGCCTCAGCCCTGGAGATGAGG + Intronic
988547787 5:32174277-32174299 CCGCCTCCGCCTTGGAGCTCGGG - Exonic
988807384 5:34753107-34753129 CTGCCTCCACCCTGGGCTTCTGG - Intronic
990219647 5:53573671-53573693 CTGCTTAAGCCCAGGAGCTCAGG - Intronic
991040424 5:62169439-62169461 CTGGCTCAGAGCTGTGGCTCTGG - Intergenic
993945343 5:94111522-94111544 CCCCCTCAGCCCTGTGGCTGGGG - Exonic
994759191 5:103832535-103832557 CTTCCTCAGCCCTGGTGGACTGG - Intergenic
996542535 5:124645715-124645737 CTGACTGACCCATGGGGCTCTGG + Intronic
997475171 5:134138563-134138585 CTGACTCAACCCTGGGGGGCAGG + Intronic
997625510 5:135328206-135328228 CTGCCTCACCCCAAGGGCACAGG - Intronic
997696121 5:135862481-135862503 CTGCCTCAAAGCAGGGGCTCAGG - Intronic
997759477 5:136431326-136431348 CTCCCTCCTCCCTGGGGCTGGGG + Intergenic
999434520 5:151553016-151553038 CTGCCTCTTCCCTGGTTCTCTGG - Intronic
999711746 5:154323975-154323997 TTGCCTGCTCCCTGGGGCTCTGG + Intronic
999992759 5:157064291-157064313 CTGCTTGAGCCCAGGAGCTCAGG + Intergenic
1000150637 5:158497313-158497335 CTGGCTCAGCCAAGAGGCTCTGG - Intergenic
1000729739 5:164818697-164818719 CTCTCTCAGCACTGCGGCTCTGG + Intergenic
1001544689 5:172563674-172563696 CTACCACAGCCCAGTGGCTCTGG + Intergenic
1001930004 5:175666127-175666149 CTGCCTGAGCCCTGAGGCCCTGG + Intronic
1002043110 5:176528538-176528560 GGGATTCAGCCCTGGGGCTCAGG + Exonic
1002107730 5:176888498-176888520 GGGCCTGAGCCCTGGGGCTTCGG - Exonic
1002279161 5:178120732-178120754 GTGCCTCAGCACTGGGGTACAGG + Intronic
1002346221 5:178549106-178549128 CTGCCTCAGCCCCGAGGAGCTGG + Intronic
1002443490 5:179276088-179276110 CTGACTCATCCCTGGGTCTCAGG + Intronic
1002471675 5:179439313-179439335 CTGGCTCAGCCCTGGCTCTTGGG - Intergenic
1002521401 5:179794907-179794929 CTACCCCAGCCCTGGGGTCCTGG + Intronic
1002561155 5:180083204-180083226 CTGGCTCAGCTCAGGGGCCCAGG - Intergenic
1002745046 5:181463563-181463585 CTCCTTCACCCCTGGGCCTCAGG - Intergenic
1002994859 6:2273081-2273103 TTGCCTCAGCCCTGAGGAACTGG - Intergenic
1003357313 6:5385880-5385902 CTGGCTTATCCCTGGGGCTCAGG + Intronic
1003421638 6:5963562-5963584 CTGCCAAAACCCTGGGACTCAGG + Intergenic
1003534751 6:6966999-6967021 CTGCCTCAGTTCTTGGCCTCAGG + Intergenic
1004990585 6:21133362-21133384 CTTTCCCAGCCCTGGTGCTCAGG + Intronic
1005674125 6:28136892-28136914 CTGCCTAAGCACTTGGGTTCCGG + Intergenic
1006368562 6:33630641-33630663 CTGCCACAGGCCTGGGTTTCTGG - Intronic
1006603620 6:35241840-35241862 CTGGAGCAGCCCTGGGGCTGGGG - Exonic
1006650831 6:35549919-35549941 CAGCCTTTGCCCAGGGGCTCTGG - Intergenic
1006808627 6:36805642-36805664 CCGTCCCAGCCCTGGGGCCCAGG - Intronic
1006944657 6:37777474-37777496 CTGACTCCTCCCTGGGGCCCAGG - Intergenic
1007073135 6:39050496-39050518 TTGCCTTAGGCCTGGGGCTAAGG - Intronic
1007113203 6:39325436-39325458 CTGCCCCAGCCCAGGGGATGGGG + Intergenic
1007113481 6:39327161-39327183 CTGCCCCAGCCCAGGGGATGGGG + Intergenic
1007247507 6:40473036-40473058 CTGCCTCATCCCTGCCTCTCGGG + Intronic
1007269442 6:40624897-40624919 CAGCCCCAGCCCTGGGGACCAGG - Intergenic
1007410007 6:41656028-41656050 CTGCCACAGCCCTGCGGAGCAGG - Intergenic
1011075267 6:83431393-83431415 CTGCCCCCGCCCTGGGTCTCTGG - Intergenic
1012491775 6:99789932-99789954 CAGCCACAGCCCTGGTGCTCAGG + Intergenic
1013227902 6:108133910-108133932 CTGCCCCAGCCCAGGGCCTGCGG + Intronic
1013293926 6:108742083-108742105 CTGCCCCATCTCTGTGGCTCTGG - Intergenic
1013420205 6:109960329-109960351 CTGCCTCAGCCCTGAGTAGCTGG - Intergenic
1013617453 6:111858226-111858248 CTGCCTCCTCTCTGGGACTCTGG - Intronic
1013857458 6:114591397-114591419 CTGCCTCCTCCCTTGGGCTGGGG + Intergenic
1015045671 6:128773657-128773679 TAGCCTCAGCCCTGGAGCTAAGG + Intergenic
1017232895 6:152091926-152091948 CTAACTCAGCCCTGTGGCTTGGG + Intronic
1018627477 6:165793466-165793488 CTGCCTGAGACCCGGGGCTGGGG + Intronic
1018817310 6:167343197-167343219 CTGACACAGCCCTGGGGCTCGGG - Intronic
1018857589 6:167685716-167685738 CTCCCTGAGCCCTGGGGCATGGG - Intergenic
1018900556 6:168049774-168049796 CTGCCCCAGCCCTGGGCCCTGGG - Intergenic
1019032276 6:169023998-169024020 CTGCGGCCGCCCTGGGGCTGCGG - Intergenic
1019249957 6:170737109-170737131 CTCCTTCACCCCTGGGCCTCAGG - Intergenic
1019297468 7:285782-285804 CCGCCTCAGTCCTCGGGGTCTGG + Intergenic
1019422677 7:958368-958390 CTGCCTCAGCTGTGGGGATGGGG + Intronic
1019444202 7:1062732-1062754 CTGCCTCCGCCCTGCTGCACAGG + Intronic
1019515456 7:1438030-1438052 CACCCTCAGTCCTGGGGCTGGGG - Intronic
1020210676 7:6155862-6155884 CTGCTTCAGCCCTCAGCCTCTGG + Intronic
1021959066 7:25854285-25854307 CAACCTCGGCCCTGTGGCTCCGG + Intergenic
1023616493 7:42025272-42025294 CCTCCCCAGCCCAGGGGCTCGGG - Exonic
1023843620 7:44109512-44109534 CTGCCCCAGCCCTGGACCCCAGG + Intronic
1023866332 7:44240165-44240187 CTGCCAGCGCCCTGGGCCTCAGG + Intronic
1023879734 7:44311708-44311730 CCGCCCCAGCTCTGGGCCTCAGG + Intronic
1023909167 7:44541509-44541531 CTGACTCAGCCCTCTGGCTTCGG - Intergenic
1024118055 7:46211497-46211519 CTGCCACAGCCCTGCGGCCTGGG + Intergenic
1024407654 7:49000955-49000977 CTGCCTCAGTCCTGCAGCTCTGG - Intergenic
1024556109 7:50604874-50604896 CTCCCTCACCCCTGAGGCTTAGG - Intronic
1024700402 7:51899814-51899836 CTGCCTCAGCCCAGCTGCACTGG - Intergenic
1024963860 7:55004842-55004864 GTGCCTCAGCCCTCGGGGCCGGG - Intergenic
1025107935 7:56188211-56188233 CTGCCTGAGCACTGGTGCTTAGG + Intergenic
1027222136 7:76220786-76220808 CAGCCCCAGCCTTGGGGCTCTGG + Intronic
1029286293 7:99468435-99468457 CTGCCCCAGCCCTGGGGAGTGGG - Intergenic
1029547611 7:101218597-101218619 CTTCCTCAGCCCTCGGGTCCTGG + Intronic
1030077439 7:105748673-105748695 CTCCCTCAGGCCTGAGGCTTGGG + Intronic
1033610729 7:142961301-142961323 CTCCCCCAGCCCTGGGGCCCAGG - Intronic
1034253000 7:149707026-149707048 CTGGCTGATCCCTGGGGCTGGGG + Intergenic
1034467859 7:151240296-151240318 CTGCCCCAGCCCCGGGGCCCTGG - Intronic
1035173339 7:157033099-157033121 CTGCCCCAGCTCTGTGGCTCTGG - Intergenic
1035603542 8:913909-913931 ATGTCTCAGTCCCGGGGCTCCGG - Intergenic
1035692164 8:1567362-1567384 CAGCCTCAGTCCTGGGGTTTTGG + Intronic
1035893318 8:3370310-3370332 CTGCCTCTACCCTCCGGCTCTGG - Intronic
1036649622 8:10634022-10634044 CTGCCTCAGGCCTGCAGCTGGGG - Intronic
1036885991 8:12553904-12553926 CTGCCTCAGCCTTGAGTCTCTGG - Intergenic
1036893603 8:12612986-12613008 CTGCCTCAGCCTTGAGTCTCTGG - Intergenic
1036910751 8:12755344-12755366 CGGCCTCGGCCCTGCGGCGCTGG + Exonic
1037231507 8:16664335-16664357 AAGACTGAGCCCTGGGGCTCTGG + Intergenic
1037804353 8:22050738-22050760 CTGCTCCCGCCCTGGGTCTCTGG + Intronic
1037994450 8:23342173-23342195 CTGCCCGATCCCTGGGACTCAGG - Intronic
1038039255 8:23710136-23710158 CTGCCTAAGCGCTGGCGCCCAGG + Intergenic
1039505203 8:38047030-38047052 CTCCCTCACCCCTCGGGCACTGG + Intronic
1041082921 8:54230461-54230483 CTGGCACAGCCCTGGGGCCGGGG - Intergenic
1041162700 8:55061236-55061258 CTGCCTCAGCCCCAGTGCCCTGG + Intergenic
1043588479 8:81797578-81797600 CAGCCTCACCTCTGGTGCTCAGG + Intergenic
1044010966 8:86994165-86994187 CTGTCACAGCCCTGGGGCAATGG + Intronic
1046587673 8:116167741-116167763 CTGTCTCTTCCCTGGGGGTCAGG - Intergenic
1046768744 8:118098032-118098054 GTGGCTCTGCCCTGGGGCTGGGG + Intronic
1046779118 8:118196177-118196199 CTGCCTCCGCTCAGGGTCTCAGG - Intronic
1046846956 8:118928134-118928156 CTGCCTCAGCCCTGAGTAGCTGG + Intronic
1047203298 8:122783375-122783397 CTGCCTGAGACCTGGAGATCTGG - Intronic
1047330775 8:123884831-123884853 CTGCCCAAACTCTGGGGCTCAGG - Intronic
1047468553 8:125144178-125144200 AAGCCTCAGGCCTGGGCCTCAGG + Intronic
1047510725 8:125513382-125513404 CTCCCACAGACCTGGGGTTCAGG - Intergenic
1047779890 8:128102521-128102543 TTGCCTCACCTCTGGTGCTCCGG + Intergenic
1048163124 8:132038957-132038979 CTGCATCAGCCGTGGGGCTGAGG - Intronic
1049036106 8:140077513-140077535 CTGCCTCAGCCCTGGGGCTCAGG - Intronic
1049042423 8:140122790-140122812 GTGACTCAGCCATGAGGCTCAGG + Intronic
1049164122 8:141116223-141116245 CTGCATCAGCCCAGGTCCTCGGG - Intergenic
1049235092 8:141508300-141508322 CCGCCTTAGGCCTGGGGCTGCGG + Intergenic
1049353568 8:142176980-142177002 CTGGCTCTGTCCCGGGGCTCAGG - Intergenic
1049372524 8:142274613-142274635 CTGCCCGTGCCCTAGGGCTCTGG - Intronic
1049557617 8:143291011-143291033 CTGCCACAGCCCCGGGGGCCTGG + Intronic
1049624066 8:143612291-143612313 CTGCCTCAGCCTGAGGGCTCTGG - Intergenic
1051313004 9:15796749-15796771 CCTCCTCAGCCCTGGGGTTGGGG + Intronic
1052855243 9:33402814-33402836 CTTCCCCAGGGCTGGGGCTCAGG - Intergenic
1052985594 9:34484920-34484942 CCACCTCTGCCCTGGGGGTCAGG - Intronic
1053062373 9:35042444-35042466 CAGCTTCATCCCTGGTGCTCTGG + Exonic
1053170923 9:35882491-35882513 CTGCCTGAGCCCTGGAGTCCAGG - Intergenic
1053350675 9:37411477-37411499 ATGACTCTGCCCTGGGGCCCAGG + Intergenic
1053683255 9:40499156-40499178 CTTCCCCAGGGCTGGGGCTCAGG - Intergenic
1053933236 9:43127472-43127494 CTTCCCCAGGGCTGGGGCTCAGG - Intergenic
1054280459 9:63125772-63125794 CTTCCCCAGGGCTGGGGCTCAGG + Intergenic
1054296360 9:63334654-63334676 CTTCCCCAGGGCTGGGGCTCAGG - Intergenic
1054394377 9:64639159-64639181 CTTCCCCAGGGCTGGGGCTCAGG - Intergenic
1054429026 9:65144358-65144380 CTTCCCCAGGGCTGGGGCTCAGG - Intergenic
1054501358 9:65877177-65877199 CTTCCCCAGGGCTGGGGCTCAGG + Intergenic
1055161372 9:73132497-73132519 CAGGCTCAGCCGTGGGGCTTCGG + Intergenic
1055296688 9:74840496-74840518 CTGCCTCACCCCAGGTTCTCTGG - Intronic
1055375900 9:75648156-75648178 CTGACACTGCCCTGGGGCCCTGG + Intergenic
1055612006 9:78032360-78032382 CTGCCTCAGCCCACCGGCCCGGG + Intergenic
1056728402 9:89142566-89142588 CTGCCTCAGCCCTGAGTAGCTGG - Intronic
1057181827 9:93034721-93034743 GTGCCTCAGGCCTGAGGCTCTGG - Intronic
1057296894 9:93851650-93851672 CTGCTCCAGCCCTGTGGCCCAGG + Intergenic
1057297717 9:93859307-93859329 GTGCCTCAGCCCTGTAGCTGGGG + Intergenic
1057443433 9:95097975-95097997 CTCCCCCAGCCCGGGGGCTCGGG - Intergenic
1057476994 9:95411477-95411499 CAGCCTCTTCCCTGGGGCTGGGG + Intergenic
1057643675 9:96853360-96853382 CTGCCTCTGCTCTGAAGCTCGGG + Intronic
1059432811 9:114260129-114260151 CTGCCTCAGGCGCGGGGCTCAGG + Intronic
1060199632 9:121645120-121645142 CTGGCCCAGGCCTGGGGCTGAGG - Intronic
1060245399 9:121941807-121941829 CTGCCTCTGCCCAGTCGCTCAGG + Intronic
1061001520 9:127905452-127905474 CTGACCCAGCCCTTGGGCCCAGG - Intergenic
1061007255 9:127935210-127935232 CAGGACCAGCCCTGGGGCTCAGG - Exonic
1061167887 9:128934887-128934909 CTGCCACAGCACTGGGGATAGGG + Intronic
1061177889 9:129008474-129008496 CTGCTTCTGACCTGTGGCTCTGG - Exonic
1061425082 9:130493609-130493631 CTGGGTCAGCCCAGGGGCTGCGG - Intronic
1061452882 9:130678145-130678167 CTGGCTCAGCCCTGCAGCCCTGG + Intronic
1061488826 9:130934135-130934157 CTGCCTCAGGCCAGAGCCTCAGG + Intronic
1061818325 9:133208935-133208957 CTGCTCCGGCCCTGGGCCTCGGG + Intronic
1061899409 9:133665385-133665407 CTGACACAGCCCTGGGGCCATGG - Intronic
1061900848 9:133671239-133671261 CTGCCTGACACCTGGGGGTCAGG - Intronic
1061962160 9:133993693-133993715 CTGGCTCAGCCCGGAGGCTGGGG + Intergenic
1062126250 9:134864562-134864584 TCGGCTCAGCCCTGGGGCTCTGG - Intergenic
1062162205 9:135086946-135086968 CTGCATAAGGTCTGGGGCTCAGG - Intronic
1062242126 9:135546423-135546445 CTGCTCCGGCCCTGGGCCTCGGG - Intronic
1062268202 9:135696935-135696957 CAGCCTCTGCCCAGGGGCCCTGG + Intronic
1062279541 9:135745807-135745829 GGGTCTCAGCCCTGGGCCTCTGG + Intronic
1062359278 9:136179920-136179942 CCGCATCAGGCCTGGTGCTCCGG + Intergenic
1062360293 9:136185074-136185096 CTGCGTCTGGCCTGGGGGTCGGG - Intergenic
1062398644 9:136362960-136362982 CTGGCCCAGCCCTGGGGTACAGG + Intronic
1062483416 9:136762950-136762972 CTGCCTGAGTTCTGGGGCTGGGG - Intronic
1062525046 9:136974811-136974833 CTGTCTCCACCCTGGGGCCCCGG - Intergenic
1062526548 9:136980190-136980212 TTAACTCAGCCCTGGGGGTCTGG - Exonic
1062554326 9:137107140-137107162 CTGCCTCGGCCCTGGTACCCTGG - Intronic
1062674634 9:137733564-137733586 CTTCCTCAGCCCTGTGGTGCAGG + Intronic
1203579516 Un_KI270745v1:29694-29716 CTCCTTCAACCCTGGGCCTCAGG - Intergenic
1186408672 X:9326586-9326608 CTCCCTCAGCCCCCAGGCTCAGG + Intergenic
1186529617 X:10282120-10282142 CTGCCCCAGCTCCTGGGCTCTGG + Intergenic
1186587193 X:10887902-10887924 CAGAATCAGCCCTGGGGATCAGG - Intergenic
1187547306 X:20266708-20266730 CCGCCGCTGCCGTGGGGCTCGGG - Exonic
1187872603 X:23776951-23776973 TTGCCTGAGCCCTGGAGTTCAGG + Intergenic
1189486490 X:41436700-41436722 CTGCCTCAGCTCCTAGGCTCAGG - Intergenic
1190124009 X:47687392-47687414 CTGCTCCTGCCCTGAGGCTCTGG - Intergenic
1192213615 X:69142972-69142994 CTGCCTCAGCCCCGCCTCTCGGG - Intergenic
1193080907 X:77405084-77405106 CTGACTGTGCCCTGGGGCTGGGG - Intergenic
1195111606 X:101656501-101656523 CTCCCTCTGCGCTGGGTCTCGGG + Exonic
1196881396 X:120201034-120201056 CTGCCTCTGCCCAAGGGTTCTGG - Intergenic
1197472897 X:126884102-126884124 CTTGCTCAGCCCTGGGGGACAGG - Intergenic
1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG + Intergenic
1198428384 X:136542035-136542057 CGGCCTCAGGACTGGGGCTGGGG - Intronic
1199758468 X:150887061-150887083 CTGCCTCAAGCCCTGGGCTCAGG - Intronic
1200165128 X:154030599-154030621 CTGCTCAAGTCCTGGGGCTCAGG + Exonic
1200759665 Y:7026320-7026342 CTGCCTCACCCCTGGGAATCAGG + Intronic
1202597980 Y:26563315-26563337 CTCCCTCAGCCCTAGGGGTAGGG + Intergenic