ID: 1049037084

View in Genome Browser
Species Human (GRCh38)
Location 8:140085189-140085211
Sequence GTCACTCCTGTAACTACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049037084_1049037086 -4 Left 1049037084 8:140085189-140085211 CCTGCTGTAGTTACAGGAGTGAC 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1049037086 8:140085208-140085230 TGACGTGGACTATGTGATGAAGG No data
1049037084_1049037089 28 Left 1049037084 8:140085189-140085211 CCTGCTGTAGTTACAGGAGTGAC 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1049037089 8:140085240-140085262 CCCACACGCCCACGTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049037084 Original CRISPR GTCACTCCTGTAACTACAGC AGG (reversed) Intronic
901286410 1:8082743-8082765 GTCACGCCTGTAATCCCAGCGGG + Intergenic
901488873 1:9585754-9585776 GTCACTCCTGTCACCCAAGCTGG - Intergenic
902053042 1:13579228-13579250 CTCAATCCTTTAACTACAGTGGG + Intergenic
906018947 1:42609660-42609682 TCCAATCCTGTAACTACAGTTGG - Intronic
907834674 1:58097719-58097741 GTCACTTCTTTAACTCCATCTGG - Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922364483 1:224851288-224851310 CTCACTTCTGTAACTACTGAAGG - Intergenic
922531898 1:226351198-226351220 CTCACTCCTGTAATCCCAGCAGG - Intergenic
923080549 1:230649648-230649670 ATCACTGCTGTAATTACAGGGGG - Intronic
1068237292 10:54254743-54254765 GTGACTACTTTAACCACAGCAGG + Intronic
1068806527 10:61200581-61200603 TTCACTACAGTAACTACAGGAGG + Intergenic
1073241200 10:102059404-102059426 GTAATTGCTGTAATTACAGCTGG - Intergenic
1074307704 10:112294160-112294182 GTCACTGCTGTAACTCCAGCAGG - Intronic
1087102828 11:94381533-94381555 CTCACTCCTGTGACAAAAGCAGG - Intronic
1091965337 12:4735878-4735900 GTCAGTCCCTTAAATACAGCTGG - Intronic
1093776800 12:23084850-23084872 GTCACCCCTATAGCTCCAGCTGG + Intergenic
1094681501 12:32671397-32671419 GTCTCTACTGAAAATACAGCCGG + Intergenic
1095828885 12:46561675-46561697 GTCAAGCCTGGAACTACATCAGG + Intergenic
1096629215 12:52914904-52914926 GTCAGCCCTGGAACTTCAGCAGG - Intronic
1097383959 12:58927277-58927299 GGCACAACTGTGACTACAGCAGG + Intergenic
1097807864 12:63985511-63985533 TTCATTTCTGTAAATACAGCAGG + Intronic
1099399610 12:82186429-82186451 GTCAATCCTATACCTACAACAGG - Intergenic
1101037775 12:100721948-100721970 CTCACACCTGTAATTCCAGCAGG - Intronic
1101860484 12:108478504-108478526 ATCACTCCTCTAACCCCAGCTGG + Intergenic
1115109820 14:29807984-29808006 CTCACTCCTGTAACTCTAGCAGG - Intronic
1117560078 14:56928503-56928525 GACACACCTGTACCTACAGGGGG - Intergenic
1119592621 14:75904009-75904031 ATAACTACTGTAACTACACCCGG + Intronic
1119782029 14:77282327-77282349 CTCATTCCTGTAACTGCACCAGG + Intronic
1120007453 14:79375437-79375459 GACACTCCTGAGACTTCAGCAGG - Intronic
1120312031 14:82841221-82841243 GTCTTTCCTGAAACTCCAGCAGG + Intergenic
1121110160 14:91307217-91307239 GTCACACCTGTAGCTAAAGAAGG - Exonic
1131997823 15:98148663-98148685 GTCACTTCTGTTTCTATAGCTGG + Intergenic
1132375795 15:101327407-101327429 GTGACGCCTGAAGCTACAGCTGG + Intronic
1133506267 16:6415429-6415451 CTCACACCTGTAATCACAGCAGG + Intronic
1134594154 16:15482154-15482176 GTCAATCTGGTACCTACAGCAGG - Intronic
1143376761 17:6471683-6471705 GTCACTCCTGGGACCTCAGCTGG - Intronic
1148391819 17:47278321-47278343 CTCACTCCTGTAATCCCAGCAGG + Intronic
1148567736 17:48643488-48643510 ATTATTCCTATAACTACAGCTGG + Intergenic
1149796174 17:59522123-59522145 GTCACTCGTGTGACTACATCAGG - Intergenic
1152013787 17:77736323-77736345 GCCACTTCTGCAACCACAGCGGG - Intergenic
1153499038 18:5729779-5729801 GTCCCTCCTGTTACCACGGCTGG + Intergenic
1153756949 18:8293986-8294008 CTCACTCCTGTAATCCCAGCAGG + Intronic
1155394324 18:25370562-25370584 GTCACTCCTGAAAAAACAGCAGG + Intergenic
1156869964 18:41934032-41934054 AGCACTCCTGTTACTGCAGCAGG - Intergenic
1159479618 18:68971967-68971989 TTGACTCCTGTAAATACACCTGG + Intronic
1160886818 19:1354004-1354026 CTCACTCCTGTAATCCCAGCAGG - Intergenic
1162290937 19:9779904-9779926 GTCACTCCTGTCACTCAGGCTGG + Intronic
1163920287 19:20282341-20282363 TTGACTCATGTAAATACAGCAGG + Intergenic
1167651281 19:50730797-50730819 CTCACGCCTGTAATTGCAGCAGG + Intergenic
1167990905 19:53359970-53359992 TTCACTCATGTAAATGCAGCAGG + Intergenic
925211223 2:2048565-2048587 CTGACTCCACTAACTACAGCAGG + Intronic
925461773 2:4069241-4069263 GTCTCTCCTGTAATTACACATGG - Intergenic
930332482 2:50003201-50003223 GTCCCTTCTGTACCTACAACAGG + Intronic
933648858 2:84832985-84833007 GTGACTCCTGAGACTACAGTGGG - Intronic
935671122 2:105558022-105558044 GTTACTCCTGCAACTGCAGACGG - Intergenic
936307279 2:111354172-111354194 GTCACACCTGCAGCTACAGAGGG + Intergenic
939664499 2:144934266-144934288 GTTAGTCCTGAATCTACAGCAGG + Intergenic
940907205 2:159179973-159179995 GCCAGCCCTGTTACTACAGCAGG - Intronic
941214949 2:162695003-162695025 CTCACACCTGTAATCACAGCAGG - Intronic
942267481 2:174242944-174242966 CTCACACCTGTAATTCCAGCAGG + Intronic
943104877 2:183532094-183532116 GTCACTCATGTAACTAATTCTGG - Intergenic
948484027 2:238268522-238268544 GTCACTCCTGACAGTGCAGCTGG + Intronic
1170330535 20:15205833-15205855 GCCACTCCTTTAACAAAAGCTGG - Intronic
1172351889 20:34249505-34249527 CTCAATCTTGTAACCACAGCTGG + Intronic
1175751462 20:61500993-61501015 GTCATTCCTGTGTCCACAGCAGG + Intronic
1177784989 21:25662175-25662197 CTCACTCCTGTCACCCCAGCTGG + Intronic
1179358422 21:40683011-40683033 GTCAGTCATGTAAGGACAGCAGG + Intronic
1179724750 21:43335896-43335918 CTCACTCTTGTAAATAAAGCTGG - Intergenic
1184105369 22:42364585-42364607 TTCACGCCTGTTACTACAGCTGG + Intergenic
956370474 3:68553703-68553725 GTAAATCCTCTCACTACAGCTGG + Intergenic
956712331 3:72049494-72049516 TTCTCTCCTGCAACTCCAGCAGG - Intergenic
957486975 3:80874127-80874149 TACATTCCTGTAACTATAGCGGG - Intergenic
958935816 3:100254345-100254367 GGCACTCATGTAACTCCAGTGGG - Intergenic
960963988 3:123091953-123091975 GACAATCCTATAACTAAAGCAGG - Intronic
961862526 3:129928040-129928062 GCCACTCTGGTAACTACGGCAGG + Intergenic
962937892 3:140098260-140098282 GTCATTTTTGTAACTACACCAGG + Intronic
964258821 3:154810991-154811013 GTCACCCCAGTAACAACTGCTGG + Intergenic
968214415 3:196876275-196876297 CTCACGCCTGTAATTCCAGCAGG + Intronic
968687685 4:1972516-1972538 GGCATTCCTGTGACTCCAGCGGG + Intronic
969272334 4:6111255-6111277 GTCACTCCAGGTACTACAGCAGG + Intronic
969600927 4:8176005-8176027 CTCACTCCAGAAAATACAGCTGG + Intergenic
970667881 4:18358616-18358638 GTCATTTCTGTATCTAGAGCTGG + Intergenic
972091647 4:35293727-35293749 GTAACTCCTTAAACTACAGCTGG + Intergenic
972777908 4:42260367-42260389 GACACTGCTGTAACTACCACAGG + Intergenic
974341236 4:60616995-60617017 GTCACTACTGTAATTCCAGAGGG - Intergenic
975162146 4:71136280-71136302 GGCTCTTCTGTAACTACATCAGG - Intergenic
978104521 4:104884986-104885008 GTCACTCCTGGAACCCCATCAGG + Intergenic
980395548 4:132209336-132209358 TTCACTGCTGTATCTGCAGCTGG - Intergenic
981646454 4:147004132-147004154 GTCACTCCTGTAAATTCAGGTGG + Intergenic
981914456 4:150018419-150018441 GTCACTCCTGTCCTTACAACAGG + Intergenic
982116187 4:152100157-152100179 GTCACTCCTCTACCCACCGCTGG - Intergenic
982317763 4:154048478-154048500 GTCACTCCTCTCCCTACAGGAGG - Intergenic
986242359 5:5972517-5972539 CTCACACCTGTAATTTCAGCAGG - Intergenic
987856991 5:23433130-23433152 CTCACTCCTGGAACTTCATCTGG - Intergenic
989823646 5:45827299-45827321 GTAAAGCCTGTAACTACAGCTGG + Intergenic
991480211 5:67069810-67069832 GTCACTCTGGTAACTATTGCAGG - Intronic
993252624 5:85548665-85548687 GGCACTCCTGTGACCACTGCTGG - Intergenic
994281340 5:97906760-97906782 GTCACTCCTGTTCTTACAGCAGG - Intergenic
995935323 5:117504387-117504409 GTGACTCATGTAGCTACATCTGG - Intergenic
998651498 5:144126085-144126107 GTCACTCCTGCACCTTCTGCAGG + Intergenic
999966806 5:156818993-156819015 TTCACTCCTGTAGCCAAAGCAGG + Intergenic
1009403688 6:63287427-63287449 CTCACTCCTGTAATACCAGCAGG + Intronic
1016760711 6:147733560-147733582 TTCACTCCTGAGACTACAGTTGG - Intronic
1017706131 6:157124547-157124569 GGCACACCTGTAAAAACAGCTGG + Intronic
1018555866 6:165050161-165050183 GTCATTCCTGCAACCACAGGTGG + Intergenic
1018657938 6:166057877-166057899 TTCTCTCCTGTAAATACAGCAGG + Intergenic
1022268634 7:28784395-28784417 GTCACTGCTTTAACCACAGCAGG + Intronic
1028038239 7:86013433-86013455 GTCACTGTTGTAACTAAACCAGG - Intergenic
1029912736 7:104172153-104172175 CTAACTCCTGTTAATACAGCAGG + Intronic
1038067641 8:23979759-23979781 GACACTCATATAACTGCAGCTGG - Intergenic
1038712083 8:29956789-29956811 GTCACTCCTGAATATTCAGCTGG - Intergenic
1039964789 8:42276103-42276125 CTCACACCTGTAATTTCAGCAGG - Intronic
1041499704 8:58527186-58527208 GTCACTCCAGTGGCTCCAGCCGG - Intergenic
1042541923 8:69916004-69916026 GTCACTCCTGTGACAGCATCTGG - Intergenic
1048295914 8:133213087-133213109 GCCTCTACTGTGACTACAGCGGG + Exonic
1048679716 8:136827074-136827096 TACACACCTGTAACTTCAGCAGG - Intergenic
1049037084 8:140085189-140085211 GTCACTCCTGTAACTACAGCAGG - Intronic
1050209349 9:3235791-3235813 GTTACTCTTGTAACTACATTGGG + Intronic
1051257549 9:15230715-15230737 CTCACTCCTGTAATCCCAGCAGG + Intronic
1055524698 9:77119603-77119625 GTCATTCTTGTAACTCAAGCCGG + Intergenic
1188083307 X:25872562-25872584 GTCTCAGCTGTAGCTACAGCAGG - Intergenic
1189120778 X:38392485-38392507 GACAACCCTGTAACTAGAGCTGG - Intronic
1189567751 X:42260982-42261004 GTCACATCTCTTACTACAGCTGG - Intergenic
1202172041 Y:22060263-22060285 ATAACTCCAGTAACTCCAGCTGG - Intergenic
1202219321 Y:22526108-22526130 ATAACTCCAGTAACTCCAGCTGG + Intergenic
1202323859 Y:23669957-23669979 ATAACTCCAGTAACTCCAGCTGG - Intergenic
1202546912 Y:26000097-26000119 ATAACTCCAGTAACTCCAGCTGG + Intergenic