ID: 1049038415

View in Genome Browser
Species Human (GRCh38)
Location 8:140094597-140094619
Sequence CGGAGAGGCAGCAGAGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049038408_1049038415 16 Left 1049038408 8:140094558-140094580 CCAACACAACTGGTACCTACCAG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1049038415 8:140094597-140094619 CGGAGAGGCAGCAGAGTAGAGGG No data
1049038413_1049038415 -10 Left 1049038413 8:140094584-140094606 CCTGACAGCTACTCGGAGAGGCA 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1049038415 8:140094597-140094619 CGGAGAGGCAGCAGAGTAGAGGG No data
1049038406_1049038415 25 Left 1049038406 8:140094549-140094571 CCATGTAACCCAACACAACTGGT 0: 1
1: 0
2: 3
3: 52
4: 614
Right 1049038415 8:140094597-140094619 CGGAGAGGCAGCAGAGTAGAGGG No data
1049038407_1049038415 17 Left 1049038407 8:140094557-140094579 CCCAACACAACTGGTACCTACCA 0: 1
1: 0
2: 0
3: 4
4: 122
Right 1049038415 8:140094597-140094619 CGGAGAGGCAGCAGAGTAGAGGG No data
1049038404_1049038415 28 Left 1049038404 8:140094546-140094568 CCACCATGTAACCCAACACAACT 0: 1
1: 1
2: 0
3: 18
4: 154
Right 1049038415 8:140094597-140094619 CGGAGAGGCAGCAGAGTAGAGGG No data
1049038410_1049038415 -3 Left 1049038410 8:140094577-140094599 CCAGTGACCTGACAGCTACTCGG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1049038415 8:140094597-140094619 CGGAGAGGCAGCAGAGTAGAGGG No data
1049038409_1049038415 1 Left 1049038409 8:140094573-140094595 CCTACCAGTGACCTGACAGCTAC 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1049038415 8:140094597-140094619 CGGAGAGGCAGCAGAGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049038415 Original CRISPR CGGAGAGGCAGCAGAGTAGA GGG Intronic
No off target data available for this crispr