ID: 1049039077

View in Genome Browser
Species Human (GRCh38)
Location 8:140098888-140098910
Sequence TCCTCCGCAGCCGTGCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049039069_1049039077 10 Left 1049039069 8:140098855-140098877 CCGCGATCCACAAAGTAATGACG No data
Right 1049039077 8:140098888-140098910 TCCTCCGCAGCCGTGCACAGGGG No data
1049039070_1049039077 3 Left 1049039070 8:140098862-140098884 CCACAAAGTAATGACGCCCGCCC No data
Right 1049039077 8:140098888-140098910 TCCTCCGCAGCCGTGCACAGGGG No data
1049039068_1049039077 11 Left 1049039068 8:140098854-140098876 CCCGCGATCCACAAAGTAATGAC No data
Right 1049039077 8:140098888-140098910 TCCTCCGCAGCCGTGCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049039077 Original CRISPR TCCTCCGCAGCCGTGCACAG GGG Intronic