ID: 1049039357

View in Genome Browser
Species Human (GRCh38)
Location 8:140100378-140100400
Sequence CAGGAGTGCCTCAATTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049039348_1049039357 29 Left 1049039348 8:140100326-140100348 CCGCAGCCGTCAGCAGGGTAGCG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1049039357 8:140100378-140100400 CAGGAGTGCCTCAATTCACAGGG No data
1049039353_1049039357 2 Left 1049039353 8:140100353-140100375 CCAGCCAGGTCTCAGCGCATGGC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1049039357 8:140100378-140100400 CAGGAGTGCCTCAATTCACAGGG No data
1049039354_1049039357 -2 Left 1049039354 8:140100357-140100379 CCAGGTCTCAGCGCATGGCTTCA 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1049039357 8:140100378-140100400 CAGGAGTGCCTCAATTCACAGGG No data
1049039349_1049039357 23 Left 1049039349 8:140100332-140100354 CCGTCAGCAGGGTAGCGACACCC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1049039357 8:140100378-140100400 CAGGAGTGCCTCAATTCACAGGG No data
1049039351_1049039357 3 Left 1049039351 8:140100352-140100374 CCCAGCCAGGTCTCAGCGCATGG 0: 1
1: 0
2: 0
3: 16
4: 128
Right 1049039357 8:140100378-140100400 CAGGAGTGCCTCAATTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049039357 Original CRISPR CAGGAGTGCCTCAATTCACA GGG Intronic
No off target data available for this crispr