ID: 1049045116

View in Genome Browser
Species Human (GRCh38)
Location 8:140143868-140143890
Sequence ACTATGTATGGTCTGCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049045111_1049045116 28 Left 1049045111 8:140143817-140143839 CCATTCCATATTCCATCAATTCT 0: 1
1: 0
2: 1
3: 31
4: 420
Right 1049045116 8:140143868-140143890 ACTATGTATGGTCTGCCATCTGG No data
1049045112_1049045116 23 Left 1049045112 8:140143822-140143844 CCATATTCCATCAATTCTAAAAT 0: 1
1: 0
2: 24
3: 78
4: 562
Right 1049045116 8:140143868-140143890 ACTATGTATGGTCTGCCATCTGG No data
1049045113_1049045116 16 Left 1049045113 8:140143829-140143851 CCATCAATTCTAAAATTCTTATC 0: 1
1: 0
2: 4
3: 25
4: 392
Right 1049045116 8:140143868-140143890 ACTATGTATGGTCTGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049045116 Original CRISPR ACTATGTATGGTCTGCCATC TGG Intronic
No off target data available for this crispr