ID: 1049046870

View in Genome Browser
Species Human (GRCh38)
Location 8:140159314-140159336
Sequence GTGTGGGATAAATCCATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049046870_1049046873 6 Left 1049046870 8:140159314-140159336 CCAGTCATGGATTTATCCCACAC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1049046873 8:140159343-140159365 AATAGTGCCTTGCACAGAGCAGG No data
1049046870_1049046875 14 Left 1049046870 8:140159314-140159336 CCAGTCATGGATTTATCCCACAC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1049046875 8:140159351-140159373 CTTGCACAGAGCAGGCCCTCAGG No data
1049046870_1049046876 17 Left 1049046870 8:140159314-140159336 CCAGTCATGGATTTATCCCACAC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049046870 Original CRISPR GTGTGGGATAAATCCATGAC TGG (reversed) Intronic
902104690 1:14024706-14024728 GTGTGGGATAAACCCAGGGGAGG + Intergenic
903990123 1:27261574-27261596 CTGTGAGATAAATGGATGACTGG + Intronic
908390862 1:63682422-63682444 GTGTGTGAGGAACCCATGACAGG - Intergenic
912558606 1:110534233-110534255 GTGTGTGCTAAAGCCATGACAGG + Intergenic
912770231 1:112456939-112456961 GTGGGGGATAAATCCCTGGATGG - Exonic
919724023 1:200870449-200870471 GTGTGGGAGAAATTCTTGACAGG + Intergenic
1064506753 10:16039358-16039380 GTGTGGGCTAATTACATGCCTGG - Intergenic
1067429493 10:46233783-46233805 GAGTGGAATGAATCCATGTCTGG + Intergenic
1067699300 10:48557211-48557233 GTGTGGGTGAGATCCATCACTGG + Intronic
1072542248 10:96406962-96406984 GTGTGGGAGCAATCCAGGAGGGG - Intronic
1073631169 10:105150617-105150639 GTGTGGAATAAATGCTTGTCAGG + Intronic
1074927546 10:118088630-118088652 GTCTGAGATAAATCCAAGAGGGG + Intergenic
1075269838 10:121039073-121039095 TAGAGGGATAAATCCATGTCTGG - Intergenic
1078172038 11:8935642-8935664 GTGTGGGATAGGTCACTGACTGG + Intergenic
1089102342 11:115974050-115974072 TGGTGGGATGAATCCAAGACCGG - Intergenic
1089807441 11:121104157-121104179 ATGAAGGATAAATCCATGCCAGG + Intronic
1092578755 12:9817275-9817297 GTGTGAGCTAAATCCTTTACTGG - Intergenic
1092765862 12:11852179-11852201 GGGTGGGACAAGACCATGACAGG + Intronic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1098335676 12:69402142-69402164 GTGTGGAATAGTTCCAGGACGGG - Intergenic
1098617749 12:72551590-72551612 ATGTGGAATAAATGAATGACTGG - Intronic
1103100021 12:118165315-118165337 GTGTGGGATGAATAAATGCCTGG - Intronic
1106294765 13:28401799-28401821 GTATGAGACAAATCCATGACAGG - Intronic
1111189991 13:84794561-84794583 GTGAAAGATAAATCCATGGCTGG + Intergenic
1113250896 13:108451140-108451162 ATGTGGGATAAGTCAATGATGGG - Intergenic
1133423414 16:5666245-5666267 GTGTGGAGTAAATGCATGATTGG + Intergenic
1137286110 16:47017059-47017081 GTGTGGGATAAATGCAGGCAGGG + Intergenic
1137558643 16:49489183-49489205 GTTTGGGATAAATCCAGAGCTGG + Exonic
1138864690 16:60802440-60802462 TTTTGGGATACATCCATGTCTGG - Intergenic
1141033117 16:80606736-80606758 GTGGGAGATAATTCAATGACGGG + Intronic
1144273371 17:13641602-13641624 GTGTGGGCTCAATTCAGGACAGG + Intergenic
1151243888 17:72779517-72779539 GTGTAGGATAAATCCTTTCCTGG + Intronic
1153853422 18:9119531-9119553 CTTTGGGCTAAATCCAGGACTGG - Exonic
1154107950 18:11540428-11540450 GTCTGGCACAAATTCATGACTGG + Intergenic
1156911009 18:42410993-42411015 GTGTGGGAAAAATCTATTTCTGG - Intergenic
1159182147 18:64922164-64922186 AAGTGGGAGAAATCCTTGACTGG - Intergenic
1159981973 18:74793286-74793308 GTTTGGCATAAATCAATGTCTGG + Intronic
1160478306 18:79214749-79214771 GTGAGGCATAAATCCATGTGAGG - Intronic
1167975710 19:53224458-53224480 CTTTGGGCTAAATCCAGGACTGG + Intergenic
927077819 2:19597650-19597672 GTGTGGTATAAACCCATAAGTGG - Intergenic
928696502 2:33854965-33854987 GTGGGGGATAAAGGCATGAAGGG + Intergenic
932785106 2:74593931-74593953 GTGAGGAAGAAATCCATGAAAGG + Intronic
935200871 2:100855549-100855571 TTGTGGAATAAATGCATGATGGG - Intronic
935339417 2:102046327-102046349 GTGTGGGATAAACACCAGACTGG - Intergenic
936652875 2:114449651-114449673 GTGGGGGAGAAATCCTTAACAGG - Intronic
936720206 2:115242367-115242389 CTGTGGGATATATACATGATGGG - Intronic
939098550 2:137866169-137866191 GTATGAGCTAAATCCATAACTGG - Intergenic
941431310 2:165417574-165417596 GTGTGAGATAAAGCCATGAATGG + Intergenic
945826537 2:214727102-214727124 ATGTGGGACAAATGCATTACTGG + Exonic
946733674 2:222733199-222733221 GTTTGGGATATATCGATGCCAGG - Intergenic
946984779 2:225258780-225258802 GTCTGGGAGAAATCCCTGAAGGG + Intergenic
1169018042 20:2307593-2307615 GAATGGGATAAATCCAGGAAAGG - Intronic
1170339167 20:15304169-15304191 TTTTGGAATAAATGCATGACTGG + Intronic
1173948188 20:46968309-46968331 GTGTGGGATGAACCCAAGAATGG + Intronic
1176081888 20:63277668-63277690 ATGTGGGACGCATCCATGACGGG - Intronic
1179929477 21:44557882-44557904 GTGTGGGAGAGATGCATGCCTGG + Exonic
1183224477 22:36540095-36540117 GTGTGGGGTACATCAATGCCAGG + Intergenic
1184135475 22:42546859-42546881 GTTTTAGATAAATACATGACTGG + Intergenic
950808589 3:15629840-15629862 GTGAGGGAAAACTCCAGGACTGG - Intronic
952018226 3:28985102-28985124 GTGTGGGATAAATGCTTTATAGG + Intergenic
953098403 3:39801701-39801723 GTGTGTAAAAAAGCCATGACAGG + Intergenic
953357031 3:42264817-42264839 GCGTTGGGTAAATACATGACTGG - Exonic
967450361 3:189616277-189616299 AAGTGGGACAATTCCATGACTGG - Intergenic
969082982 4:4634162-4634184 GTGTGGGTTAAATGCAGGAATGG + Intergenic
972720404 4:41691167-41691189 GTGGGGAATAAATCCAAGAGGGG - Intronic
973974692 4:56250961-56250983 GTGTAGGATAAAGACATGAATGG - Intronic
974091891 4:57320103-57320125 GTGTGTGATAAACACATCACTGG - Intergenic
981214801 4:142151557-142151579 GTCTGGGAAAAATCCAAGCCAGG - Intronic
983675634 4:170289165-170289187 GTGTGGGATATATCACTGAAAGG - Intergenic
986700224 5:10400009-10400031 ATCTGGGACAAATCCATCACTGG + Intronic
988306651 5:29501722-29501744 GTGAGGGATAAAACCTTGAGTGG - Intergenic
1014241599 6:119023781-119023803 TTGTGAGAAAAATCAATGACAGG - Intronic
1024089710 7:45925026-45925048 TTGTGAGAGAAAGCCATGACAGG - Intergenic
1024355097 7:48406436-48406458 GTGTGCGCTCAATCAATGACAGG + Intronic
1038262597 8:26010046-26010068 GTGTGGCCTATCTCCATGACAGG - Intronic
1038401136 8:27285791-27285813 GGGTGGGATAAATACTTTACAGG + Exonic
1042386128 8:68177014-68177036 CTTTGGGCTAAATCCAGGACTGG - Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1049342657 8:142121467-142121489 GCGTGAGATAAATTAATGACGGG - Intergenic
1049852492 8:144840533-144840555 GTCTGTGATCAAACCATGACAGG - Intronic
1051958695 9:22731325-22731347 GTTTGGGAGAAATGCATCACTGG - Intergenic
1189686394 X:43568093-43568115 ATGGGGAAAAAATCCATGACTGG + Intergenic
1194076524 X:89400672-89400694 GTGTGAGATAAAACCAGGAATGG + Intergenic
1195557687 X:106245867-106245889 CTGTGGGATACATCCCTGGCTGG + Intergenic
1197155833 X:123269318-123269340 GTATGGGTTACATCCATGAAAGG + Intronic
1200429164 Y:3056192-3056214 GTGTGAGATAAAACCAGGAATGG + Intergenic