ID: 1049046871

View in Genome Browser
Species Human (GRCh38)
Location 8:140159330-140159352
Sequence AGGCACTATTCTCAGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049046871_1049046873 -10 Left 1049046871 8:140159330-140159352 CCCACACACTGAGAATAGTGCCT 0: 1
1: 0
2: 2
3: 15
4: 209
Right 1049046873 8:140159343-140159365 AATAGTGCCTTGCACAGAGCAGG No data
1049046871_1049046875 -2 Left 1049046871 8:140159330-140159352 CCCACACACTGAGAATAGTGCCT 0: 1
1: 0
2: 2
3: 15
4: 209
Right 1049046875 8:140159351-140159373 CTTGCACAGAGCAGGCCCTCAGG No data
1049046871_1049046876 1 Left 1049046871 8:140159330-140159352 CCCACACACTGAGAATAGTGCCT 0: 1
1: 0
2: 2
3: 15
4: 209
Right 1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049046871 Original CRISPR AGGCACTATTCTCAGTGTGT GGG (reversed) Intronic
903086813 1:20868447-20868469 GGGCACTAATCCCATTGTGTGGG + Intronic
904525942 1:31133983-31134005 AGGCACTATTCTGTGTGTTGGGG - Intergenic
906349504 1:45045743-45045765 AGGTACTGTTCTTAGTGTTTAGG + Intronic
906581897 1:46941697-46941719 AGGCAGTATGCTAGGTGTGTGGG + Intergenic
906706251 1:47896945-47896967 GAGCACTGTTCTCAGTATGTGGG + Intronic
907397171 1:54199255-54199277 AGGCACTGTTCTCAGTGCTGGGG + Intronic
908204558 1:61832220-61832242 AGGCACTATGCTTATTATGTGGG + Intronic
908337090 1:63137587-63137609 AGGCACTATCCTAGGTGTTTGGG - Intergenic
908972163 1:69849871-69849893 AGACACTATTCTCAGTGCCAAGG + Intronic
910823742 1:91382448-91382470 AGGCACTGTTCTAAGTATTTGGG - Intronic
911197349 1:95007958-95007980 TGGCACTATTCTAAGGGTGAGGG - Intronic
917589094 1:176458839-176458861 AGGTTCTATTCTAAGTGTGAGGG - Intergenic
918474630 1:184910703-184910725 AGACATTATGCTGAGTGTGTTGG + Intronic
918864540 1:189877957-189877979 AGTCACCCTTCTAAGTGTGTAGG + Intergenic
919252644 1:195078000-195078022 AGGCATTATCCTCATTGTGATGG - Intergenic
919566598 1:199196719-199196741 AGGCAGTATTTTGAATGTGTGGG + Intergenic
921790027 1:219279192-219279214 AGGCAATATTCTGACTATGTGGG + Intergenic
922351545 1:224738223-224738245 AGACACTATTCTCAGTGCTGGGG - Intronic
922587668 1:226747676-226747698 AGGCAGCCTTTTCAGTGTGTAGG - Intergenic
1064525569 10:16252953-16252975 AGGCACTATGCTCACTGTCTGGG + Intergenic
1065563968 10:26990553-26990575 AGGGTCTATTCTCAGCTTGTAGG - Intergenic
1066661719 10:37742930-37742952 AGGTACTGTGCTCAGTGTATGGG - Intergenic
1068163107 10:53293502-53293524 AGGCATTTTTCTCATTGTCTTGG - Intergenic
1069055107 10:63836772-63836794 AGGAACTTTCCTCAGTGTGGTGG + Intergenic
1069237205 10:66091497-66091519 AGACACTGTTCTAAGTGTGGGGG + Intronic
1069337347 10:67367929-67367951 GGGTACTATGCTCAGTATGTGGG + Intronic
1069424450 10:68277658-68277680 AGGCATTTTTCCCATTGTGTTGG - Intergenic
1072210768 10:93244892-93244914 AGGCCCTGTTCTAAGTGTTTTGG - Intergenic
1075210859 10:120489938-120489960 AGGCACTATTCTAAGTGCTGGGG + Intronic
1076566169 10:131400884-131400906 AAACATTATTCTGAGTGTGTGGG + Intergenic
1079156224 11:17950327-17950349 AGCCTCTATTCTCAATGGGTAGG - Intronic
1079469841 11:20767784-20767806 AGGCACTGTTCTGAGTGTTAAGG + Intronic
1079849892 11:25518595-25518617 AGGCACTATTCTAGGTATCTGGG + Intergenic
1079952726 11:26824236-26824258 AGGCACTTTTCCCATTGTCTTGG + Intergenic
1080082807 11:28241093-28241115 AGGTACTTTTCTCAGTGCTTGGG + Intronic
1080541884 11:33273925-33273947 AGCCACTGTTCTCATTCTGTTGG + Intronic
1083608963 11:63996076-63996098 GGGAACTCTTCTCAGTGTGGCGG + Intronic
1087574229 11:99970564-99970586 AGGCACTTTTCTAAGTGCTTTGG - Intronic
1092605561 12:10114704-10114726 AAGTACTATTCTCAGACTGTTGG + Intergenic
1092820720 12:12350892-12350914 AGGCACTATGCTAAGTGTTAGGG - Intergenic
1092915787 12:13187905-13187927 AGGCACTGTTCTAGGTGTTTGGG + Intergenic
1093508195 12:19894099-19894121 AGGCTCTATTCTTAATGTGTTGG + Intergenic
1093558359 12:20506405-20506427 AGCCTCTATTCTCTGTTTGTGGG - Intronic
1096546707 12:52345147-52345169 AGACACAATCCTCAGTGTGCAGG + Intergenic
1097461864 12:59872125-59872147 AGGCAGGATTCTGAGTCTGTGGG - Intergenic
1098098526 12:66987260-66987282 AGGCACTGTTCTTGGTGTTTGGG - Intergenic
1100417010 12:94388477-94388499 AGGCACTATGCTCAGTATCTAGG + Intronic
1100580733 12:95937820-95937842 AGGCACTGTTCTACGTGTGGGGG + Intronic
1100908608 12:99332396-99332418 AGGCCCTATTCTCAAGGAGTTGG + Intronic
1101235017 12:102779932-102779954 AGGCACTGTTCTAAGTGTTGTGG - Intergenic
1101243800 12:102865298-102865320 AGCCACTCTTCTGAGTGTCTGGG - Intronic
1102163914 12:110791031-110791053 AGGCAATATTCTCAGATTCTGGG + Intergenic
1102748814 12:115274044-115274066 AGGCACTATTCTAATTGGTTGGG + Intergenic
1104101285 12:125614222-125614244 AGGCACTATTCTCACTACCTGGG - Intronic
1105914762 13:24903250-24903272 AGGCACTATTCACAGGGATTGGG - Intronic
1106177404 13:27342961-27342983 AGGTACTATTCTCACTATTTGGG - Intergenic
1107032653 13:35869249-35869271 AGGTCCTCTTCTCTGTGTGTGGG + Intronic
1107074324 13:36305482-36305504 AGGTACTATTCTCAATGTTTAGG - Intronic
1107268247 13:38583215-38583237 AGGCACTTTTCTCAGAGCCTTGG - Intergenic
1108569300 13:51733486-51733508 AGGCATTATTCTCAGGTTGGCGG + Intronic
1108678017 13:52754711-52754733 AGGCACTATTCACAGTACTTGGG + Intergenic
1108715969 13:53078157-53078179 AGGCACTATTTTGAGTTTGAAGG + Intergenic
1116357038 14:43942116-43942138 ATGGTCTTTTCTCAGTGTGTAGG + Intergenic
1117202961 14:53411334-53411356 AGGCAGTGTTCTGGGTGTGTGGG - Intergenic
1117242982 14:53854357-53854379 AGGAACTATGCCCAGTGAGTAGG + Intergenic
1117582152 14:57162300-57162322 AGAAATTATTCTGAGTGTGTGGG - Intergenic
1118467163 14:66041463-66041485 AGGCACTATTCTAGGTGCTTGGG + Intergenic
1119154173 14:72393199-72393221 CCGCACTTTTCTCAGAGTGTTGG + Intronic
1119231270 14:72981737-72981759 AGGCTCTATTCTCAAGGTATGGG + Intronic
1122128623 14:99592616-99592638 AGCCACCATTCTCAGGGTTTGGG + Intronic
1123708134 15:22965593-22965615 AGGCACTTTTGTCATTGTGTGGG - Intronic
1124010953 15:25838222-25838244 AAGCACTTTTTTGAGTGTGTTGG - Intronic
1124234566 15:27977760-27977782 AGGCATTAATCCCAGTGTGAGGG - Intronic
1125391028 15:39193182-39193204 ATGCAATATTTTCAGTGGGTTGG - Intergenic
1129587210 15:76879934-76879956 GTTCACTATTCTCACTGTGTAGG + Intronic
1131047284 15:89324118-89324140 TGGCACTATTGTCAGTGAGCAGG + Exonic
1131866282 15:96714187-96714209 AGGCACTATGCTAAGTGGTTGGG - Intergenic
1136646036 16:31616285-31616307 AGGCACTATGCTCATTATCTGGG + Intergenic
1138606035 16:58089291-58089313 AGGCACTGTGCCCAGTGTTTTGG - Intergenic
1139974200 16:70795938-70795960 AGGCACTCTGATCAGTGTGGTGG - Intronic
1140249437 16:73282934-73282956 AGGCACTATTCTTAATGTTAGGG + Intergenic
1140817666 16:78635890-78635912 AGGCACTTTTCTCTGTGTCCTGG - Intronic
1143756623 17:9072350-9072372 ATGCACTATTCTGATTTTGTGGG + Intronic
1144965549 17:19075259-19075281 AGGCACTGTTCTCAGTGCTGGGG + Intergenic
1144982418 17:19176924-19176946 AGGCACTGTTCTCAGTGCTGGGG - Intergenic
1144985805 17:19201315-19201337 AGGCACTGTTCTCAGTGCTGGGG + Intergenic
1146146023 17:30417292-30417314 AGGCACTATTCTAGGTGCTTGGG - Intronic
1148521268 17:48277852-48277874 AGCCTGTAATCTCAGTGTGTTGG - Intronic
1148739386 17:49883807-49883829 AAGCACTTATCTCATTGTGTGGG - Intergenic
1151026070 17:70678364-70678386 AGTCACTGTTCTCAGAGTGGGGG + Intergenic
1153367947 18:4280312-4280334 AGGAACTGTTCTTAGTGTCTGGG + Intronic
1153956947 18:10104621-10104643 AAGTACTATTCTCAGTATCTGGG - Intergenic
1156104340 18:33639441-33639463 AGGAACAATTGTCAGTGTCTAGG + Intronic
1166447539 19:42871386-42871408 AGGCACTATTGTCAGAGGGAAGG + Intronic
1166470399 19:43074978-43075000 AGGCACTATTGTCAGAGGGAAGG + Intronic
926246209 2:11123808-11123830 AGGCACTGATCTCAGGCTGTGGG - Intergenic
927470484 2:23372166-23372188 AGGCACAATTCTCTCTGTGCTGG - Intergenic
928858802 2:35831031-35831053 AGGCTCTATTCTGAGGGTGATGG + Intergenic
930588026 2:53293108-53293130 AGGCACTATTCTAGGTGTTGCGG - Intergenic
931915499 2:66950660-66950682 AGGTACTGTTCTAAGAGTGTGGG - Intergenic
933086740 2:78062392-78062414 AGTCACAAATCTCAGAGTGTTGG + Intergenic
933970388 2:87465205-87465227 AATCACGATTCTCAGTGTGAAGG + Intergenic
935477561 2:103542023-103542045 GGGTACTATGCTCAGTATGTGGG + Intergenic
935611379 2:105029360-105029382 AGGAACTATGCTCAGTGCCTGGG + Intergenic
936323395 2:111485291-111485313 AATCACGATTCTCAGTGTGAAGG - Intergenic
936639665 2:114297873-114297895 GTGCACTCCTCTCAGTGTGTAGG + Intergenic
939309201 2:140451580-140451602 AGGCAGTATTTTCAGTGTTCAGG - Intronic
940748074 2:157593325-157593347 AGACAGTATTCTCAATATGTTGG + Intronic
941265017 2:163350058-163350080 CTGCACTATTTTCAGTATGTAGG - Intergenic
945341023 2:208654223-208654245 TGAAACTATTCTAAGTGTGTGGG - Intronic
945773589 2:214077446-214077468 AGGCCTTATTCTCAGTTTTTGGG + Intronic
1172021854 20:31920264-31920286 AGGCACTGTGCTGGGTGTGTGGG - Intronic
1173407194 20:42776978-42777000 AGGCACCATTCTGGGTTTGTGGG - Intronic
1173570153 20:44070769-44070791 AGGCTCTATTCTCACTCTCTGGG - Intergenic
1175074535 20:56361425-56361447 AGGCACTGTTCTCAGTGTAGGGG - Intronic
1175341731 20:58235268-58235290 CGGCACTGTTCTAAGTGGGTTGG - Intergenic
1178512070 21:33213864-33213886 GGGCACTAATCTCACTGTGAGGG + Intergenic
1179039051 21:37785475-37785497 AAACTGTATTCTCAGTGTGTTGG + Intronic
1184130921 22:42515946-42515968 GGGCACTGTCCCCAGTGTGTTGG - Intronic
951488340 3:23239727-23239749 AGGCACTGTGCTAAGTCTGTTGG + Intronic
952321161 3:32279043-32279065 AGTCTCTCTTCTCAGTGTCTTGG + Intronic
952647038 3:35672600-35672622 AGGCACTATTCTTAGTATTGGGG + Intronic
952988018 3:38804497-38804519 AAACATTATTCTCAGTGTTTGGG - Intergenic
955955079 3:64280464-64280486 AGGCACTGTTCTAAGTGTTGAGG + Intronic
958256285 3:91329488-91329510 GGGTACTATTCTCAGTATCTGGG - Intergenic
958450700 3:94268870-94268892 AGTCACTATTCTCAATGGTTTGG - Intergenic
958486789 3:94722567-94722589 AGGCCATATTCTCAATGTGAGGG - Intergenic
959535581 3:107481508-107481530 AGGCACTATACTGTGTGTGATGG + Intergenic
960443194 3:117714686-117714708 ATGCATTGTTCCCAGTGTGTTGG + Intergenic
961583793 3:127905155-127905177 AGGGACTATTATCAGTTTCTTGG - Intergenic
962830503 3:139134994-139135016 AGAAACAATTCTCAGTCTGTTGG + Intronic
963053735 3:141165425-141165447 ATTCACTTTTCTCAATGTGTAGG + Intergenic
963234405 3:142942829-142942851 AAAAACTATTCTTAGTGTGTGGG + Intergenic
965660926 3:171041072-171041094 AGGTATTATTCTCATTTTGTAGG + Intergenic
966492561 3:180544448-180544470 AGGTACTGTTCTCAGTATTTGGG - Intergenic
970512971 4:16799298-16799320 AGGCACCATGTTCAGTGTTTGGG - Intronic
970868575 4:20786339-20786361 GGGTACTATGCTCAGTGTCTAGG + Intronic
971267764 4:25110022-25110044 AGGCACTATGGTCACTGTGCTGG + Intergenic
972115158 4:35622484-35622506 GGGCACTAATCTCAGCGTGAGGG - Intergenic
972530038 4:39953443-39953465 AGCCACCACTCCCAGTGTGTTGG - Intronic
973258617 4:48138168-48138190 AGGCACTATACTTAGTGTTTTGG - Intronic
974235466 4:59175447-59175469 AGGAAGTAATCTCAGTGAGTTGG - Intergenic
975162672 4:71141725-71141747 AGGCACTGTTCTAAGTGTTGGGG - Intergenic
975300956 4:72790855-72790877 AGGCACCTTTGTCAGTGAGTAGG + Intergenic
976328448 4:83799852-83799874 AGGCACTAATCTCATCATGTGGG - Intergenic
976459854 4:85297395-85297417 AGGCACATTTTTCTGTGTGTAGG + Intergenic
976906455 4:90242365-90242387 AGGCACTATTCCCAATGTTAAGG + Intronic
979122347 4:116919871-116919893 AGGCACTTTTCCCATTGTCTTGG - Intergenic
979696221 4:123616410-123616432 TGCCACTATTCTCAGTATATTGG + Intergenic
979962942 4:127042916-127042938 GGGTACTATTCTCAGTATCTAGG + Intergenic
980634735 4:135486436-135486458 AGACACCATTGTCAGTGTGAAGG + Intergenic
981147649 4:141343755-141343777 AGGCACTGCTCTCAATCTGTTGG + Intergenic
981675717 4:147340637-147340659 AGACAATATTCTCAGTGTAGAGG + Intergenic
986975682 5:13390537-13390559 AGGGACTATGCTCAGTATCTGGG + Intergenic
987732571 5:21795478-21795500 AGGCAATATTTTAGGTGTGTGGG + Intronic
987874780 5:23667427-23667449 AGGCAATATTCCCAGGGTCTAGG - Intergenic
990821828 5:59849895-59849917 AGGCAGTGTTCTCATTGTCTGGG + Intronic
993027359 5:82662254-82662276 AGGTACTATTCTCAGTGCTAGGG - Intergenic
994264618 5:97700163-97700185 AGGTACTATGTTGAGTGTGTTGG + Intergenic
994439708 5:99786998-99787020 AGGTATTATTGTCAGTGTTTTGG + Intergenic
995616648 5:113972147-113972169 AGGCACTATTCTAGGTGCTTAGG - Intergenic
996148320 5:120002788-120002810 AGGAACTATTCTAAGTGCTTGGG - Intergenic
996843517 5:127874546-127874568 AGGCACTATACTCAGGCAGTAGG - Intergenic
997834846 5:137183973-137183995 AGCCACTGTGCTAAGTGTGTTGG - Intronic
998598000 5:143554404-143554426 AGGCAATATTCTCAGAGAGATGG - Intergenic
999128718 5:149266348-149266370 AGCCACTCTGTTCAGTGTGTGGG - Intergenic
1001237110 5:170039427-170039449 AGGCACTGTTCTCAGGGTTTGGG - Intronic
1005321178 6:24655846-24655868 ACCCACAATTGTCAGTGTGTTGG - Intronic
1006168577 6:32080174-32080196 AAGCACTATTCTAAGTGTGTGGG + Intronic
1006473323 6:34240218-34240240 AGGCAATATTGTCAGTGAGGTGG + Intronic
1011014789 6:82742966-82742988 AGGTACTATACTAAATGTGTGGG + Intergenic
1011353652 6:86451289-86451311 AGTCAGTATCCTCAGTGTGATGG + Intergenic
1011835229 6:91422573-91422595 AGGCACTATACTCAGTACCTGGG + Intergenic
1013415977 6:109924948-109924970 AGGCTCTATGCTAAGTGTGTAGG + Intergenic
1014962687 6:127706520-127706542 AGACACTATTCTAAGTGTCTGGG + Intergenic
1015060535 6:128959955-128959977 AGGCACTTTTCTAGGTGTTTAGG - Intronic
1015083801 6:129263208-129263230 TGGCACTATTTTCCCTGTGTAGG - Intronic
1017238002 6:152137425-152137447 AGGCAGTATTCTCAGCCTGTGGG - Intronic
1017703566 6:157098817-157098839 AGGCACAACTCTCAGGGTGGCGG - Intronic
1017749541 6:157478742-157478764 AGGCACTATTCTAAGTGTTAGGG - Intronic
1018485869 6:164240342-164240364 AGGCACTGTTCTAAGTGTTTGGG - Intergenic
1020435185 7:8154455-8154477 AGGGTGTATTCTGAGTGTGTTGG - Intronic
1020978738 7:15041157-15041179 TGGCACTGTTCTCAGTATTTGGG - Intergenic
1025998228 7:66541893-66541915 AGGCCCCATTCTCAATGTGGGGG - Intergenic
1027650889 7:80867424-80867446 TGGCACTTTGCTCAGTATGTGGG - Intronic
1027934470 7:84585696-84585718 AGGCAGTGTTCTCAGTGTACAGG + Intergenic
1029003320 7:97179724-97179746 TGGCACTATTTTGTGTGTGTAGG - Intronic
1031111365 7:117613530-117613552 AGGCACTATACTAAGTGTTTTGG - Intronic
1031337599 7:120555118-120555140 AGGCACTCTTGTCCCTGTGTGGG - Intronic
1031449802 7:121900780-121900802 AGGCACTGTGATCAGTGTTTGGG + Intronic
1031660826 7:124422060-124422082 AGGCAGTATGCTGAGTATGTTGG - Intergenic
1033018334 7:137695346-137695368 AAGCACTGTTCTAAATGTGTAGG + Intronic
1033674115 7:143520785-143520807 AGGCTTTATTCTGAGTGTGATGG + Intergenic
1036045361 8:5134077-5134099 AGTCACTATTCTCACTGTGTTGG - Intergenic
1038127396 8:24690092-24690114 GGGCACTAAACGCAGTGTGTGGG - Intergenic
1038643422 8:29345168-29345190 TGGCACTATTCTGAGTGTTGGGG - Intronic
1041476065 8:58267600-58267622 GGGTACTATGCTCAGTGTCTGGG - Intergenic
1044571267 8:93721687-93721709 AAGCACCATTCTAAGTGTGAAGG + Intronic
1045332893 8:101171046-101171068 AAGCACTTTTCTCTGTGGGTAGG + Intergenic
1045696337 8:104812749-104812771 AGGCACTGTGCTCAGTGTTGAGG + Intronic
1045851148 8:106699200-106699222 ACGAACTATTCTTACTGTGTGGG + Intronic
1046181026 8:110647826-110647848 AAGCACTATACTCACTATGTGGG + Intergenic
1046560704 8:115833516-115833538 AGGCAGTATTGTCACTGAGTGGG - Intergenic
1046661569 8:116952973-116952995 GGGCACTATGCTCAGTATCTCGG - Intronic
1046788730 8:118296884-118296906 AGGCACTGTTCTAAGTGCCTAGG + Intronic
1049046871 8:140159330-140159352 AGGCACTATTCTCAGTGTGTGGG - Intronic
1049238418 8:141524432-141524454 AGGCACTTTTCTCACTGAGATGG - Intergenic
1050171816 9:2827760-2827782 AAGCACTGTTCTGAGTGTTTTGG + Intronic
1050634560 9:7597612-7597634 AGGTACTATGCTCACTGTCTGGG + Intergenic
1050776183 9:9263846-9263868 AGTTACTATGCTCAGTGTCTGGG + Intronic
1051351527 9:16202270-16202292 AGGCAGTATTCTCTGTGGGATGG - Intergenic
1053255446 9:36613380-36613402 AGGCACTTTTCTAGATGTGTGGG + Intronic
1053332847 9:37231862-37231884 AGGAAGTACTCTCAGTGTTTTGG + Intronic
1054261426 9:62869236-62869258 TGACACTATTCTCAGTGTCCTGG + Intergenic
1054923586 9:70565999-70566021 AGGCACTATTCTAAGTGCTCGGG + Intronic
1057180533 9:93027289-93027311 AGGCACTGGTGTCAGTTTGTTGG + Intronic
1058908977 9:109503878-109503900 AGGCACTACTCTAAGTGCTTGGG + Intergenic
1061312025 9:129769841-129769863 AGGCACAATGCCCAGTGTGGAGG - Intergenic
1185458960 X:325088-325110 ATGCACAATTCTCTGTGTCTGGG - Intergenic
1186025670 X:5308195-5308217 TGGCAATATTTTCAGTGTTTGGG - Intergenic
1188412104 X:29885453-29885475 AGGCACTACTCTCAGTGCTTGGG - Intronic
1188601706 X:31974313-31974335 AGGTACTATGCTCACTGTTTGGG + Intronic
1192279508 X:69669770-69669792 AGGTACTATGCTCAGTGCTTGGG - Intronic
1195137809 X:101928264-101928286 AGGCACTATGCTTAGTGTTAAGG - Intronic
1196520191 X:116663186-116663208 ATGCACTCCTCTCAGTGTGCAGG + Intergenic
1196941773 X:120784311-120784333 AGGCACAATTCTGGGTCTGTTGG - Intergenic
1196960029 X:120991245-120991267 AGGCACCATTCTAGGTGTTTGGG - Intergenic