ID: 1049046872

View in Genome Browser
Species Human (GRCh38)
Location 8:140159331-140159353
Sequence AAGGCACTATTCTCAGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049046872_1049046876 0 Left 1049046872 8:140159331-140159353 CCACACACTGAGAATAGTGCCTT 0: 1
1: 0
2: 1
3: 33
4: 282
Right 1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG No data
1049046872_1049046875 -3 Left 1049046872 8:140159331-140159353 CCACACACTGAGAATAGTGCCTT 0: 1
1: 0
2: 1
3: 33
4: 282
Right 1049046875 8:140159351-140159373 CTTGCACAGAGCAGGCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049046872 Original CRISPR AAGGCACTATTCTCAGTGTG TGG (reversed) Intronic
903086812 1:20868446-20868468 AGGGCACTAATCCCATTGTGTGG + Intronic
904407498 1:30302562-30302584 AAGGCACTAATCTCATCATGAGG - Intergenic
904525943 1:31133984-31134006 CAGGCACTATTCTGTGTGTTGGG - Intergenic
906434877 1:45786901-45786923 GCTCCACTATTCTCAGTGTGAGG + Intergenic
907397170 1:54199254-54199276 CAGGCACTGTTCTCAGTGCTGGG + Intronic
908337091 1:63137588-63137610 AAGGCACTATCCTAGGTGTTTGG - Intergenic
909745775 1:79095661-79095683 CAGGCATTATTCAAAGTGTGGGG - Intergenic
910675494 1:89812407-89812429 ATGGCATAATTCTCAGTCTGAGG + Intronic
911197350 1:95007959-95007981 TTGGCACTATTCTAAGGGTGAGG - Intronic
912374742 1:109201031-109201053 AAGGCAGGATTTTCAGAGTGGGG - Intronic
913343591 1:117784571-117784593 ATTGCTATATTCTCAGTGTGTGG + Intergenic
917083296 1:171279263-171279285 AATGCAATATCCTCAGTGTGAGG - Intronic
917589095 1:176458840-176458862 AAGGTTCTATTCTAAGTGTGAGG - Intergenic
919566597 1:199196718-199196740 AAGGCAGTATTTTGAATGTGTGG + Intergenic
920517945 1:206600364-206600386 AAGGCCCTCCTCTCAGTGTCAGG - Intronic
920593898 1:207249364-207249386 ACAGCACTATGCTCAGTGTCTGG - Intergenic
921058160 1:211560276-211560298 CAGGCACTGTTCTAAGTGTTAGG - Intergenic
921620664 1:217322923-217322945 AAGGCACTGCCCTCGGTGTGAGG + Intergenic
921819406 1:219600203-219600225 CAGGCACTATTCTGAGTGCTAGG + Intergenic
922085328 1:222341401-222341423 TAGGCATTATTCTTAGTGTCAGG + Intergenic
922351546 1:224738224-224738246 CAGACACTATTCTCAGTGCTGGG - Intronic
923419946 1:233802923-233802945 AAGGCACTATTGACAGTCTGAGG - Intergenic
1063934697 10:11065770-11065792 AAGGTACTATGGTCAGGGTGAGG + Intronic
1064525568 10:16252952-16252974 CAGGCACTATGCTCACTGTCTGG + Intergenic
1064710456 10:18118656-18118678 AGGGCACTAATCTCATTATGAGG + Intergenic
1064811712 10:19207421-19207443 TAGGTACTATTCTCAGTTTCAGG - Intronic
1065662979 10:28025511-28025533 AAGCCACTAATCTCATTATGAGG + Intergenic
1066151902 10:32630433-32630455 AAGGTGCTGTTCTCAATGTGAGG + Intronic
1067001990 10:42624158-42624180 AAGGCACTAACCTCATCGTGAGG + Intronic
1067507900 10:46872139-46872161 AAGGTACTATGCCCAGTGTCGGG + Intergenic
1067654350 10:48179706-48179728 AAGGTACTATGCCCAGTGTCGGG - Intronic
1069123070 10:64593085-64593107 AAGCCACTCTTCTCAGTATTTGG + Intergenic
1069237204 10:66091496-66091518 CAGACACTGTTCTAAGTGTGGGG + Intronic
1069577024 10:69538068-69538090 AGGGCACTAATCCCATTGTGAGG + Intergenic
1072273496 10:93800356-93800378 TATGCACTATTCTGAGTGTAGGG - Intergenic
1072807085 10:98430444-98430466 AAGTCACAATTCTGGGTGTGTGG - Intronic
1075210858 10:120489937-120489959 CAGGCACTATTCTAAGTGCTGGG + Intronic
1075477823 10:122751671-122751693 AAGGTACTACTGTGAGTGTGTGG - Intergenic
1076457072 10:130607889-130607911 AAGACACTGTTCTGATTGTGGGG - Intergenic
1076597668 10:131635817-131635839 GAGGCACTGTTCTCATTCTGTGG - Intergenic
1077901338 11:6491662-6491684 CAGGCACTGTTTTCAGTGTTTGG - Intronic
1078404657 11:11059782-11059804 AAAGCCTTATTCTCAGTGTAAGG - Intergenic
1079771454 11:24464824-24464846 TAGGCAGTATTCCCAGTGTATGG - Intergenic
1079794860 11:24788518-24788540 AAGGCAGAATTTTCAGTTTGAGG - Intronic
1080165158 11:29226880-29226902 AAGGCACTAAACTCAGAGAGAGG - Intergenic
1080688409 11:34535005-34535027 AAGGCACTAATCCCATCGTGAGG + Intergenic
1080816518 11:35762980-35763002 AAGGCACTATTTTAAGTATGTGG + Intronic
1080979839 11:37388466-37388488 AAGGCACTATTTTTATTGTCTGG - Intergenic
1081401139 11:42644415-42644437 AAGACACTATTCCAAGTGTTAGG + Intergenic
1081402770 11:42661942-42661964 AAGGCACGTTTGTCAGTGAGTGG + Intergenic
1086439654 11:86815386-86815408 CAGGCACTGTTCTAATTGTGGGG - Intronic
1087566792 11:99870019-99870041 AAGGCACCACTCTCAGTGGTAGG + Intronic
1090876707 11:130796486-130796508 AAGGCACTAATCTCATCATGGGG - Intergenic
1090909400 11:131105366-131105388 AAAGCACTATATTCAGTGTCTGG + Intergenic
1092357072 12:7804907-7804929 AAGTAACAATTCTCAGTTTGGGG + Intergenic
1092568877 12:9699963-9699985 AAAGCATAATTCTCAGTGTAAGG - Intergenic
1092820721 12:12350893-12350915 CAGGCACTATGCTAAGTGTTAGG - Intergenic
1093033818 12:14314325-14314347 AAGTCACTCTGCTCAGGGTGGGG + Intergenic
1094309484 12:29063000-29063022 AGGGCACTAATCTCATTGGGAGG + Intergenic
1094828712 12:34290112-34290134 AAGGCACTATCGTCCGTGGGAGG + Intergenic
1094829614 12:34294091-34294113 AAGGCACTTCTCTCTGTGGGAGG + Intergenic
1094830099 12:34296244-34296266 AAGGCACTATCATCCGTGGGAGG - Intergenic
1094831597 12:34302775-34302797 AAGGCACTTTCCTCCGTGGGGGG - Intergenic
1094837637 12:34329572-34329594 AAGGCACTTTTGTCTGTGGGGGG + Intergenic
1094838014 12:34331256-34331278 AAGGCACTATCCTCTGTGGGTGG + Intergenic
1095093186 12:38126357-38126379 AAAACACTATTCTCAGTGTCAGG + Intergenic
1095096495 12:38152172-38152194 ATGGCACTACTGTCAGTGGGAGG - Intergenic
1097965470 12:65574609-65574631 AAGGTAATATTCACAGTGTCTGG + Intergenic
1100220183 12:92496489-92496511 AAGGAATTATTCTCAAAGTGAGG - Intergenic
1100580732 12:95937819-95937841 CAGGCACTGTTCTACGTGTGGGG + Intronic
1102163913 12:110791030-110791052 AAGGCAATATTCTCAGATTCTGG + Intergenic
1103190269 12:118995144-118995166 AAAGCACTTTTCTCAGTGCTGGG - Intronic
1104361871 12:128140891-128140913 AAGGCCCTATTGTCACTGTGTGG + Intergenic
1104626348 12:130358835-130358857 AAGGCCCTGTTCTCAGTGCTGGG - Intronic
1104847714 12:131855075-131855097 AGGGCACCAATCTCATTGTGGGG + Intergenic
1105204777 13:18211861-18211883 AAGGCACAATCCACATTGTGAGG - Intergenic
1105204875 13:18213109-18213131 AAGGCACAATACACATTGTGAGG - Intergenic
1105204962 13:18214892-18214914 AAGGCACAATCCACATTGTGAGG - Intergenic
1105914763 13:24903251-24903273 AAGGCACTATTCACAGGGATTGG - Intronic
1107644883 13:42483604-42483626 AAGGAAATATTCCCAGTATGTGG - Intergenic
1111413213 13:87904177-87904199 AAGGCACTAATCCCTTTGTGAGG + Intergenic
1111775306 13:92654017-92654039 AAGGCACTGTTCTATTTGTGGGG - Intronic
1114273706 14:21122179-21122201 TAGGCACTGTGCTAAGTGTGGGG + Intergenic
1116053850 14:39839068-39839090 CAGGCACTTTTCTAAATGTGGGG + Intergenic
1116457118 14:45133009-45133031 CAAGAACTATTCTCAGTGTTTGG - Intronic
1117582153 14:57162301-57162323 AAGAAATTATTCTGAGTGTGTGG - Intergenic
1117694699 14:58348354-58348376 CAGGCACTATTCTAAATGCGTGG - Intronic
1118050121 14:62017701-62017723 CAACCATTATTCTCAGTGTGTGG + Intronic
1119231269 14:72981736-72981758 AAGGCTCTATTCTCAAGGTATGG + Intronic
1120528210 14:85602309-85602331 AAGGGACTATTCTAAGGTTGTGG - Intronic
1121835800 14:97091040-97091062 CAGGCACTGTTCTCAGTTTGGGG + Intergenic
1122680487 14:103457752-103457774 AAAGTACTTATCTCAGTGTGTGG - Intronic
1122709079 14:103642246-103642268 AAGGCACTAATCCCACCGTGAGG + Intronic
1123708135 15:22965594-22965616 TAGGCACTTTTGTCATTGTGTGG - Intronic
1124234567 15:27977761-27977783 CAGGCATTAATCCCAGTGTGAGG - Intronic
1126335541 15:47583038-47583060 TATGCACTATTCTCAGTGCTAGG + Intronic
1126675704 15:51157898-51157920 AAGGCACTGTGATCAGTGAGAGG + Intergenic
1129813050 15:78526230-78526252 CAGGCACTGTTCTAGGTGTGGGG + Intronic
1130862469 15:87903353-87903375 AGGGCAACATTCTCAGTGAGTGG + Intronic
1130970430 15:88727922-88727944 AAGTTACTATGCTCAGTGTCAGG + Intergenic
1135160865 16:20094999-20095021 TAGGTACTGTTCTAAGTGTGAGG + Intergenic
1137465492 16:48704963-48704985 AAGTAACTATGCTCAGTTTGAGG + Intergenic
1137934357 16:52619981-52620003 CAGGTACTATTCTCAGTGCTTGG - Intergenic
1139277789 16:65743942-65743964 AAGGCACTAATCCCATTATGAGG - Intergenic
1140249436 16:73282933-73282955 CAGGCACTATTCTTAATGTTAGG + Intergenic
1140621836 16:76743846-76743868 CAGGCAGCATTCTCAGTGTGGGG - Intergenic
1141270285 16:82533510-82533532 AAAGCATTCCTCTCAGTGTGGGG - Intergenic
1144965548 17:19075258-19075280 AAGGCACTGTTCTCAGTGCTGGG + Intergenic
1144982419 17:19176925-19176947 AAGGCACTGTTCTCAGTGCTGGG - Intergenic
1144985804 17:19201314-19201336 AAGGCACTGTTCTCAGTGCTGGG + Intergenic
1148739387 17:49883808-49883830 AAAGCACTTATCTCATTGTGTGG - Intergenic
1150593160 17:66580657-66580679 AGTGCAATATTGTCAGTGTGCGG + Intronic
1151026069 17:70678363-70678385 CAGTCACTGTTCTCAGAGTGGGG + Intergenic
1151171542 17:72250494-72250516 AAGGAAGTGTTCTCAGTGAGTGG + Intergenic
1152473934 17:80505435-80505457 CAGGCACCATTGTCATTGTGTGG - Intergenic
1155674510 18:28413588-28413610 AAAACACTCTTCTCTGTGTGGGG + Intergenic
1157991882 18:52506678-52506700 AAGACACTATTTCCAGAGTGGGG - Intronic
1158886070 18:61828779-61828801 AAGGCACTACTCTAGGTTTGGGG + Intronic
1160242907 18:77135970-77135992 AAGACACTAATCCCATTGTGAGG + Intergenic
1160924539 19:1537231-1537253 AGGCCACAATTCTCAGTGCGAGG + Intergenic
1163396651 19:17067267-17067289 AAGGCACTCTGCTAAGTGTCAGG + Intronic
1164507029 19:28869438-28869460 AACTCACTATTATCAGTGAGGGG + Intergenic
1168445548 19:56409235-56409257 CAGGCACTATTCTAAGAGTCAGG - Intronic
925093240 2:1172260-1172282 AAGGCTCCTTTCTCAGTGTTGGG + Intronic
925570218 2:5302609-5302631 AAGGCACTATTCATAGTTTCAGG + Intergenic
925749470 2:7074697-7074719 CAGGTACTCTGCTCAGTGTGGGG - Intergenic
925903757 2:8526976-8526998 AATGCAGATTTCTCAGTGTGAGG + Intergenic
926211104 2:10870049-10870071 AGGGCTCTATTCTGAGTGTTGGG + Intergenic
926362945 2:12107211-12107233 CAGGCACTATTCTCAGTTAGAGG - Intergenic
926621234 2:15048886-15048908 GAGGCACTGTGGTCAGTGTGTGG + Intergenic
926905037 2:17797822-17797844 AAGGGACTGTGCTCAGTCTGAGG - Intronic
927415683 2:22878183-22878205 ACGTCACTGTTCTCAGTTTGAGG + Intergenic
929474834 2:42235478-42235500 AAAACACTATACACAGTGTGTGG + Intronic
933133947 2:78707910-78707932 AAGCCACTAATCTCATTATGAGG - Intergenic
933537632 2:83596662-83596684 AAGGTGCTATGCTCAGAGTGGGG - Intergenic
933584059 2:84160989-84161011 AAAGCACTTTTCACAGTGAGAGG + Intergenic
935131368 2:100263729-100263751 AAGGAATACTTCTCAGTGTGGGG + Intergenic
939179156 2:138783850-138783872 AAGGTAGTCTTCACAGTGTGAGG + Intergenic
940181114 2:150934208-150934230 AAGCCACTGTTGTCAGTGAGAGG + Intergenic
940721609 2:157288656-157288678 TAGGCATTATTCTCAGTATAAGG + Intronic
941496680 2:166213923-166213945 AAGGCACTGTGCTCAGGGTGGGG - Intronic
941555303 2:166972089-166972111 AAGGCACTAGTCCCATTATGGGG - Intronic
942003498 2:171674582-171674604 AAGGCATTATTCGCTGTGTGTGG - Intergenic
944521636 2:200575895-200575917 AGGGCACTATTCTCTTTGTTGGG - Intronic
945773588 2:214077445-214077467 AAGGCCTTATTCTCAGTTTTTGG + Intronic
946149079 2:217751993-217752015 ATGGGACTTGTCTCAGTGTGAGG - Intronic
946806722 2:223477869-223477891 CAGGCACTATGCTCACTCTGGGG + Intergenic
947052863 2:226066347-226066369 AAGTCACTAATCTCATTATGAGG + Intergenic
1169933085 20:10854781-10854803 AAGGCACTACTGTCAGACTGAGG - Intergenic
1171996321 20:31734431-31734453 AAGTCACCATACTAAGTGTGGGG - Intergenic
1173580805 20:44145198-44145220 CAGGCACTGGTCTCACTGTGGGG + Intronic
1174200616 20:48804203-48804225 CAGGCACTGTTCTAGGTGTGGGG + Intronic
1175074536 20:56361426-56361448 CAGGCACTGTTCTCAGTGTAGGG - Intronic
1176712865 21:10269935-10269957 AAGGCACAATCCACATTGTGAGG - Intergenic
1176712963 21:10271797-10271819 AAGGCACAATCCACATTGTGAGG - Intergenic
1176713063 21:10274119-10274141 AAGGCACAATCCACATTGTGAGG - Intergenic
1176713102 21:10324377-10324399 AAGGCACAATCCACATTGTGAGG + Intergenic
1176713202 21:10326225-10326247 AAGGCACAATCCACATTGTGAGG + Intergenic
1176869097 21:14072495-14072517 AAGGCACTGTCCTCCGTGGGAGG + Intergenic
1177586321 21:23101265-23101287 AAGGCGCTCTGCGCAGTGTGGGG + Intergenic
1178512069 21:33213863-33213885 AGGGCACTAATCTCACTGTGAGG + Intergenic
1180760794 22:18202514-18202536 AAGGCACAATCCACACTGTGAGG + Intergenic
1180760880 22:18203358-18203380 AAGGCACAATCCACACTGTGAGG + Intergenic
1180760990 22:18205954-18205976 AAGGCACAATCCACACTGTGAGG + Intergenic
1180764450 22:18236911-18236933 AAGGCACAATCCACACTGTGAGG - Intergenic
1180764537 22:18237773-18237795 AAGGCACAATCCACACTGTGAGG - Intergenic
1180771104 22:18386565-18386587 AAGGCACAATCCACACTGTGAGG + Intergenic
1180771190 22:18387401-18387423 AAGGCACAATCCACACTGTGAGG + Intergenic
1180774679 22:18418832-18418854 AAGGCACAATCCACACTGTGAGG - Intergenic
1180774789 22:18421302-18421324 AAGGCACAATCCACACTGTGAGG - Intergenic
1180774875 22:18422146-18422168 AAGGCACAATCCACACTGTGAGG - Intergenic
1180807840 22:18730051-18730073 AAGGCACAATCCACACTGTGAGG - Intergenic
1180807952 22:18733853-18733875 AAGGCACAATCCACACTGTGAGG - Intergenic
1180829134 22:18889358-18889380 AAGGCACAATCCACATTGTGAGG + Intergenic
1180829475 22:18894508-18894530 AAGGCACAATCCACACTGTGAGG + Intergenic
1181070792 22:20337969-20337991 AAGGCACAATCCACACTGTGAGG - Intergenic
1181070879 22:20338815-20338837 AAGGCACAATCCACACTGTGAGG - Intergenic
1181193777 22:21166028-21166050 AAGGCACAATCCACACTGTGAGG - Intergenic
1181193861 22:21166913-21166935 AAGGCACAATCCACACTGTGAGG - Intergenic
1181193948 22:21167768-21167790 AAGGCACAATCCACACTGTGAGG - Intergenic
1181215493 22:21325010-21325032 AAGGCACAATCCACACTGTGAGG + Intergenic
1181215579 22:21325863-21325885 AAGGCACAATCCACACTGTGAGG + Intergenic
1181215664 22:21326712-21326734 AAGGCACAATCCACACTGTGAGG + Intergenic
1181525819 22:23485679-23485701 AAGGCACAATCCACATTGTGAGG + Intergenic
1181525915 22:23487061-23487083 AAGGCACAATCCACACTGTGAGG + Intergenic
1183311963 22:37115023-37115045 ATGGTACTATTCTCGGTGGGAGG + Intergenic
1184920742 22:47603989-47604011 AGAGCACTAATCTCATTGTGAGG + Intergenic
1203232940 22_KI270731v1_random:127729-127751 AAGGCACAATCCACACTGTGAGG + Intergenic
1203233028 22_KI270731v1_random:128603-128625 AAGGCACAATCCACACTGTGAGG + Intergenic
1203279225 22_KI270734v1_random:115345-115367 AAGGCACAATCCACATTGTGAGG + Intergenic
1203279565 22_KI270734v1_random:119813-119835 AAGGCACAATCCACACTGTGAGG + Intergenic
949303945 3:2618052-2618074 AAGGCACTGTCCTAAGTGTGTGG - Intronic
951172635 3:19559792-19559814 AAGCCAGAATTCCCAGTGTGGGG - Intergenic
952647037 3:35672599-35672621 CAGGCACTATTCTTAGTATTGGG + Intronic
954305570 3:49723701-49723723 AAGGCACTGATCTTAGTGGGGGG - Exonic
957130774 3:76220429-76220451 AAGGCACTAATCCCTGTGTGAGG - Intronic
958486790 3:94722568-94722590 AAGGCCATATTCTCAATGTGAGG - Intergenic
959984741 3:112560533-112560555 AATGTACCAATCTCAGTGTGGGG - Intronic
960481816 3:118200743-118200765 AAGGCCCAATTCTCAGTATCAGG + Intergenic
960607801 3:119526129-119526151 AAGCCACTCTTCTATGTGTGGGG + Intronic
962488832 3:135870896-135870918 AAGTTTCTATTCTCACTGTGGGG + Intergenic
963327680 3:143880318-143880340 TAGGCACAGTTCTAAGTGTGGGG + Intergenic
963736332 3:149021242-149021264 ATGGCACTATGCTCAGTGTGTGG - Intronic
964450545 3:156808552-156808574 AAGGCACTAGTATTAGTCTGAGG - Intergenic
965180245 3:165393577-165393599 AAGGCATCATTCTAAGTCTGCGG - Intergenic
966222487 3:177564741-177564763 AAAGCACTTTTCTAAATGTGGGG - Intergenic
969694070 4:8725091-8725113 AGGGCACTGTTCCCAGGGTGCGG - Intergenic
970431279 4:15991113-15991135 AAGGGATTACTCACAGTGTGAGG + Intronic
971314904 4:25559635-25559657 CAGGCACAGTTCTCAGTGCGGGG - Intergenic
971762759 4:30789501-30789523 AAAGCACTATTTTCTGTGTGAGG - Intronic
971863238 4:32136644-32136666 AAGGCACTAATCTCATAATGAGG + Intergenic
972115159 4:35622485-35622507 AGGGCACTAATCTCAGCGTGAGG - Intergenic
972892003 4:43568609-43568631 AAGGCATAAATCTCAGTCTGAGG + Intergenic
975162673 4:71141726-71141748 CAGGCACTGTTCTAAGTGTTGGG - Intergenic
975526155 4:75352727-75352749 AAGGCACTAGTCCTAGTGTTGGG + Intergenic
976148463 4:82067611-82067633 AAGGCACTAATTCCATTGTGAGG + Intergenic
976328449 4:83799853-83799875 AAGGCACTAATCTCATCATGTGG - Intergenic
976783003 4:88782834-88782856 AAGGCACTGCTCTCAGTGCGTGG - Intronic
977172431 4:93779978-93780000 AAGACACTATTCTGTGTGTTGGG + Intergenic
978608761 4:110512378-110512400 AAGATCCTGTTCTCAGTGTGAGG - Intronic
978871775 4:113587065-113587087 ATAGCACTATTTTCAGTGTCAGG + Intronic
980445823 4:132906411-132906433 AAGGCACTAATCCCATTATGAGG - Intergenic
981035200 4:140161958-140161980 AGGGCACTAATCTCATTATGAGG - Intergenic
981462188 4:145026278-145026300 AGGGCACTATTCTCATTGGTTGG + Intronic
984994165 4:185412287-185412309 AAGGAACTATTCTTTTTGTGAGG + Intronic
985567597 5:628327-628349 AAGGAACTATGCTCAGTGTCAGG + Intronic
988220847 5:28345298-28345320 AAGGCACTAATCTCACCATGAGG + Intergenic
988702848 5:33692501-33692523 AAGGAACTATTCTAAGTGCTGGG - Intronic
989080925 5:37620221-37620243 AAAGAACTATTCTCATTGAGTGG + Intronic
991533839 5:67644712-67644734 AGGGCACTAATCTCATTGTAAGG - Intergenic
993027360 5:82662255-82662277 CAGGTACTATTCTCAGTGCTAGG - Intergenic
994278481 5:97869348-97869370 AGGGCACTAATCTCAGTATGGGG + Intergenic
996148321 5:120002789-120002811 AAGGAACTATTCTAAGTGCTTGG - Intergenic
998637357 5:143971058-143971080 CAGGCACTGTTCTCAGTGCTGGG + Intergenic
1000935036 5:167297163-167297185 AAGTCACTATGCTAAGTATGAGG - Intronic
1001237111 5:170039428-170039450 CAGGCACTGTTCTCAGGGTTTGG - Intronic
1001966009 5:175910397-175910419 CAGGCACTGTCCTCAGTGTGGGG - Intergenic
1002250937 5:177928803-177928825 CAGGCACTGTCGTCAGTGTGGGG + Intergenic
1002837918 6:880851-880873 AAGGCACAGTACTCAGTGAGGGG - Intergenic
1003970810 6:11297340-11297362 ACTGCACTAATATCAGTGTGAGG - Intronic
1005434978 6:25799816-25799838 AAGGCACTATGCTCAGAGGGAGG + Intronic
1006168576 6:32080173-32080195 CAAGCACTATTCTAAGTGTGTGG + Intronic
1008030168 6:46686827-46686849 ACGGCACTTTTCACATTGTGTGG - Intergenic
1008043531 6:46828422-46828444 AAGGCACGTGCCTCAGTGTGAGG + Intronic
1009566246 6:65314389-65314411 CAGGCACTATTCTGAGTGCTAGG - Intronic
1009974703 6:70660342-70660364 AAGGAACTCTCCTCAGTGTGGGG - Intergenic
1011715028 6:90096535-90096557 CAGGCACTATTCCAAGTGTCAGG - Intronic
1013840510 6:114386821-114386843 AAGGCACTAATCCCATTCTGAGG - Intergenic
1014878828 6:126696117-126696139 AAGGCACTAATCTCATCATGGGG - Intergenic
1014962686 6:127706519-127706541 CAGACACTATTCTAAGTGTCTGG + Intergenic
1017238003 6:152137426-152137448 CAGGCAGTATTCTCAGCCTGTGG - Intronic
1017749542 6:157478743-157478765 CAGGCACTATTCTAAGTGTTAGG - Intronic
1018485870 6:164240343-164240365 CAGGCACTGTTCTAAGTGTTTGG - Intergenic
1019074769 6:169378547-169378569 GAGGACCTGTTCTCAGTGTGGGG - Intergenic
1019791940 7:3020020-3020042 AAGGCACTAATCTCATTGCAAGG - Intronic
1020381861 7:7556526-7556548 CAGGAACGAGTCTCAGTGTGTGG - Intergenic
1020497581 7:8875960-8875982 ATGGTATTATTCTCAGTCTGAGG + Intergenic
1020978739 7:15041158-15041180 ATGGCACTGTTCTCAGTATTTGG - Intergenic
1020985746 7:15132287-15132309 CAGGCACTACTCTCAGAGTTGGG + Intergenic
1024118040 7:46211326-46211348 AAGCCACCCTTCTGAGTGTGGGG - Intergenic
1025998229 7:66541894-66541916 GAGGCCCCATTCTCAATGTGGGG - Intergenic
1027112189 7:75449108-75449130 AAGGCTGCATTCGCAGTGTGGGG + Intronic
1027284424 7:76633649-76633671 AAGGCTGCATTCGCAGTGTGGGG + Intergenic
1029981831 7:104886184-104886206 TAGGCACTATTCTAGGTGTGGGG - Intronic
1031139899 7:117930979-117931001 AAGGCAGTATGCTAAGTGTAGGG - Intergenic
1031449801 7:121900779-121900801 AAGGCACTGTGATCAGTGTTTGG + Intronic
1032383584 7:131506571-131506593 AAATCACTATTCACAGTGAGTGG - Exonic
1033818442 7:145103689-145103711 AAGGAAATATTCACAATGTGTGG + Intergenic
1033915217 7:146315421-146315443 AAGGCACTGTGCTCAGGGTGGGG + Intronic
1035931705 8:3786844-3786866 AAGGCACTAATCACATTATGAGG + Intronic
1037286630 8:17308319-17308341 ATGGCATTATTTTCAGTTTGGGG - Intronic
1037385525 8:18336365-18336387 AAGGCACTGTGCTCAGGATGGGG - Intergenic
1037714456 8:21385255-21385277 AGGGCACTAATCTCATCGTGAGG + Intergenic
1038106165 8:24437130-24437152 TAGGCAATATGCTCAGTGTAGGG + Intergenic
1038643423 8:29345169-29345191 CTGGCACTATTCTGAGTGTTGGG - Intronic
1039021099 8:33207517-33207539 AATGTGCTATTCTCATTGTGGGG - Intergenic
1039762131 8:40589337-40589359 GAGGCAATATTCACAGTGGGAGG - Intronic
1039765578 8:40624840-40624862 AAGGCAGCATTCTCAGTGGCTGG - Intronic
1039776832 8:40745419-40745441 AATGCAGTTTTCTGAGTGTGGGG - Intronic
1040011288 8:42663152-42663174 CAGGCACTGTGCTCTGTGTGAGG - Intergenic
1040112354 8:43572110-43572132 AAAGCACTGATCTCAGTGGGGGG + Intergenic
1040275488 8:46011648-46011670 AAAGCATCACTCTCAGTGTGGGG - Intergenic
1040669117 8:49665804-49665826 AAGGCACTAACCTCATTCTGAGG + Intergenic
1042353411 8:67800800-67800822 CAGGCACTGTTCTAGGTGTGTGG + Intergenic
1042353746 8:67803751-67803773 CAGGCACTGTTCTAGGTGTGTGG - Intergenic
1045176602 8:99731851-99731873 TAGGCACTATTCACTTTGTGAGG + Intronic
1046560705 8:115833517-115833539 AAGGCAGTATTGTCACTGAGTGG - Intergenic
1046696296 8:117343654-117343676 ATAGCACTGTTTTCAGTGTGTGG - Intergenic
1047683002 8:127274258-127274280 CAGGGACTATTCTCAGTTTCTGG - Intergenic
1049046872 8:140159331-140159353 AAGGCACTATTCTCAGTGTGTGG - Intronic
1049331499 8:142056459-142056481 AAGGCACTGTTCTCCCTGGGTGG + Intergenic
1050382295 9:5042656-5042678 AAGGCCGTTTTCTCAGTGGGAGG + Intronic
1050593270 9:7181594-7181616 AAGGCCCATTTCTGAGTGTGGGG - Intergenic
1050632996 9:7580539-7580561 CAGGCAGTAATCTTAGTGTGGGG + Intergenic
1050633148 9:7581692-7581714 AGGGCACTAATCTTATTGTGGGG - Intergenic
1051370866 9:16357995-16358017 GAGACAATCTTCTCAGTGTGTGG + Intergenic
1052221814 9:26033143-26033165 AATGCTCTGTTCTCAGTGTTTGG - Intergenic
1054923585 9:70565998-70566020 CAGGCACTATTCTAAGTGCTCGG + Intronic
1057931191 9:99194816-99194838 AGGGCACTAATCCCATTGTGAGG - Intergenic
1060056574 9:120419065-120419087 AGGGCACTGATCTCACTGTGAGG - Intronic
1185458961 X:325089-325111 AATGCACAATTCTCTGTGTCTGG - Intergenic
1185999276 X:4989669-4989691 AATGCACCATTCACACTGTGTGG - Intergenic
1186025671 X:5308196-5308218 ATGGCAATATTTTCAGTGTTTGG - Intergenic
1187560583 X:20399199-20399221 AAGGCAGGATTGGCAGTGTGGGG - Intergenic
1188412105 X:29885454-29885476 CAGGCACTACTCTCAGTGCTTGG - Intronic
1189150088 X:38697831-38697853 TAGGCACTATTCTGATTGTGGGG + Intergenic
1192013219 X:67298559-67298581 AAGGCACTTTTGTCTGTGAGTGG - Intergenic
1192166135 X:68828825-68828847 ATGGCACCAATCTGAGTGTGCGG - Intergenic
1193080259 X:77399564-77399586 GAGGCACTATTATGAGTGTCAGG - Intergenic
1194477718 X:94379433-94379455 AAGGCACTAATCTATGTATGAGG + Intergenic
1197210073 X:123821020-123821042 AGGAAACTGTTCTCAGTGTGAGG + Intergenic
1199045592 X:143167555-143167577 AAGGCAATGTACTCAGTGTTGGG + Intergenic
1199519845 X:148723085-148723107 AAGCCACACTTCTCATTGTGTGG - Intronic
1201764164 Y:17563841-17563863 AAGGCACTATCGTCCGTGGGAGG + Intergenic
1201764725 Y:17566308-17566330 AAGGCACTATCGTCCGTGGGAGG + Intergenic
1201836828 Y:18339682-18339704 AAGGCACTATCGTCCGTGGGAGG - Intergenic
1201837389 Y:18342149-18342171 AAGGCACTATCGTCCGTGGGAGG - Intergenic