ID: 1049046876

View in Genome Browser
Species Human (GRCh38)
Location 8:140159354-140159376
Sequence GCACAGAGCAGGCCCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049046870_1049046876 17 Left 1049046870 8:140159314-140159336 CCAGTCATGGATTTATCCCACAC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG No data
1049046871_1049046876 1 Left 1049046871 8:140159330-140159352 CCCACACACTGAGAATAGTGCCT 0: 1
1: 0
2: 2
3: 15
4: 209
Right 1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG No data
1049046872_1049046876 0 Left 1049046872 8:140159331-140159353 CCACACACTGAGAATAGTGCCTT 0: 1
1: 0
2: 1
3: 33
4: 282
Right 1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049046876 Original CRISPR GCACAGAGCAGGCCCTCAGG AGG Intronic
No off target data available for this crispr