ID: 1049047477

View in Genome Browser
Species Human (GRCh38)
Location 8:140164444-140164466
Sequence CTGAAGAGGAAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1744
Summary {0: 1, 1: 0, 2: 20, 3: 226, 4: 1497}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049047477_1049047481 23 Left 1049047477 8:140164444-140164466 CCTTCTTCCTTCTTCCTCTTCAG 0: 1
1: 0
2: 20
3: 226
4: 1497
Right 1049047481 8:140164490-140164512 TTTTCCCATCCCTCAGACGCTGG No data
1049047477_1049047482 24 Left 1049047477 8:140164444-140164466 CCTTCTTCCTTCTTCCTCTTCAG 0: 1
1: 0
2: 20
3: 226
4: 1497
Right 1049047482 8:140164491-140164513 TTTCCCATCCCTCAGACGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049047477 Original CRISPR CTGAAGAGGAAGAAGGAAGA AGG (reversed) Intronic
900943963 1:5819198-5819220 CTGAAGGGGGATAAGGCAGAAGG - Intergenic
901189071 1:7393843-7393865 CTGGAGAGGGAGGATGAAGAGGG - Intronic
901269733 1:7942513-7942535 CAGAAGCAGAAGAAGGCAGACGG + Intronic
901284553 1:8066707-8066729 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
901295482 1:8157923-8157945 AGGAGGAGGAAGAAGAAAGAAGG + Intergenic
901644360 1:10708803-10708825 GGGAAGAGGAAGAGGGAAGGTGG + Intronic
901727118 1:11250543-11250565 ATGAAGAGGACCAAGGCAGATGG - Intronic
902242236 1:15096712-15096734 CACATGGGGAAGAAGGAAGAGGG + Intronic
902275036 1:15333347-15333369 GGGAAGAGGAGGAAGGAGGAGGG + Intronic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902554497 1:17238973-17238995 GTGAACAGGGATAAGGAAGAGGG - Intronic
902672312 1:17983319-17983341 CTGCGGTGGCAGAAGGAAGAGGG + Intergenic
902795943 1:18800378-18800400 CGGAACAGGAGGAAGGAAGAAGG - Intergenic
902817604 1:18925239-18925261 CTGAGGAGGAGAGAGGAAGAGGG - Intronic
903011056 1:20330725-20330747 AGGGAGAGGGAGAAGGAAGAGGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903052365 1:20611299-20611321 CAGAAGAGTAAGAAGGATGGTGG + Intronic
903296559 1:22347059-22347081 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
903455627 1:23484620-23484642 CAGCAGAGGAGGGAGGAAGAGGG - Intergenic
903458033 1:23502095-23502117 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
903728855 1:25474476-25474498 CTGAAGAAGAAAAAGCAAAAAGG - Intronic
903743944 1:25574199-25574221 CTGGAGAGGAGGGAGGAAGGAGG + Intergenic
903857819 1:26346985-26347007 GAGAAAAGGAAGAAGGCAGAAGG + Intronic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904295768 1:29518891-29518913 AGGAGAAGGAAGAAGGAAGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904589866 1:31607029-31607051 CTGGAGAGGAAGAAATAAAATGG - Intergenic
904827640 1:33284635-33284657 CTGAAGAGTTAGTTGGAAGAAGG + Intronic
904901917 1:33864480-33864502 CAGAAGAGTAGGAAGGATGATGG - Exonic
904949913 1:34228608-34228630 CTGGAGAGCAACAAGGAACAAGG - Intergenic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905074884 1:35261699-35261721 AAGAGGAGGAAGGAGGAAGAAGG - Intergenic
905092022 1:35437324-35437346 CTGAGGAGGAAGGAGGGAGAAGG - Intronic
905129005 1:35738053-35738075 CTGAAGAAGAAGAAGAAATTGGG - Exonic
905137839 1:35813780-35813802 AGGAAGAGGAAGAAGGAAGAAGG + Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905489366 1:38331680-38331702 CTGAGGAGGAGGAAGGCAGGTGG - Intergenic
905716548 1:40156331-40156353 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
905766652 1:40607323-40607345 CTGGACATGAAGTAGGAAGAGGG - Intergenic
905788858 1:40779475-40779497 CTGCACAGGGAAAAGGAAGAAGG + Intergenic
905885573 1:41489983-41490005 ATGGAGAGAAAGAAGGCAGATGG - Intergenic
906091566 1:43183993-43184015 CTAGAGAGGAAGAGGGAAAATGG - Intronic
906124154 1:43416345-43416367 TTCAAGAGGAAGAAGCAGGAGGG + Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906181866 1:43827950-43827972 CTGATGAAGAAGAAGAAAGTTGG + Intronic
906234906 1:44200369-44200391 CTGGAGATGAAGGAGAAAGAAGG - Intergenic
906283457 1:44569737-44569759 CTGAGGGGGAACAAGGAGGAAGG + Intronic
906477398 1:46178972-46178994 CTGAAGAGACAGAAGAGAGAGGG - Intronic
906844336 1:49174888-49174910 CTGAGGATGAAGAAGACAGAAGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907728032 1:57038606-57038628 CTGAATTGGAAGCTGGAAGAAGG - Intronic
908053145 1:60255018-60255040 TTGAACTGGGAGAAGGAAGAGGG - Intergenic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908457963 1:64322417-64322439 CTGAATATGAATAAGGCAGAGGG + Intergenic
908878539 1:68704667-68704689 CTGAAGAGAGAACAGGAAGATGG + Intergenic
909043211 1:70678224-70678246 CTGAGGAGGAAGAGGGAAACAGG + Intergenic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909267867 1:73584799-73584821 GTGAAGAGGGAGAATAAAGATGG + Intergenic
909288121 1:73847115-73847137 GGGAAGAGGAAGAAGGAGTAGGG - Intergenic
909315569 1:74213645-74213667 TTGAAGAGTAAATAGGAAGACGG - Intronic
909477276 1:76094947-76094969 ACCAAGAGGAAGAAGAAAGAAGG - Intronic
909494268 1:76260781-76260803 CTTAAGAGGAATAAGAGAGATGG - Intronic
909540785 1:76789229-76789251 GAGAAGAGAAAGAGGGAAGATGG + Intergenic
909549969 1:76887044-76887066 CTGAGAAGGAAGAAAAAAGAGGG - Intronic
910039607 1:82833996-82834018 CTGAAGAGAGAAAAGGATGAAGG - Intergenic
910460302 1:87441927-87441949 CTGGAGAGGAAGAAGGATCAAGG + Intergenic
910774852 1:90864516-90864538 TAGAAGAAGAAGAAGAAAGAAGG - Intergenic
910798862 1:91125268-91125290 CAGAAGAGAAAGCTGGAAGACGG - Intergenic
911008753 1:93255777-93255799 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911058954 1:93731532-93731554 CTGGAAAGGAAGAAGGTACAAGG + Intronic
911210981 1:95137662-95137684 ACAGAGAGGAAGAAGGAAGAGGG - Intronic
911214028 1:95172555-95172577 GTGATGAGGAAGAAGGAAGGAGG - Intronic
911583445 1:99662053-99662075 CTAATGGGGAAGAAGGAAAAGGG + Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
911700936 1:100951032-100951054 CTGGAGGGGAAGAAGGGAAATGG + Intronic
911888879 1:103341572-103341594 ATGAAGAGGAGGAAGAAAGCAGG - Intergenic
912095491 1:106137129-106137151 CAGAAGAAGAAGGAGAAAGAGGG + Intergenic
912128056 1:106564973-106564995 ATGAACATGAAGAAGGTAGAAGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912269720 1:108196800-108196822 CTCCACAGGAAGAAAGAAGATGG + Intronic
912379260 1:109238286-109238308 CTCAAGGGGAAGGTGGAAGATGG + Intergenic
912565940 1:110587468-110587490 CTGATGGGGAGGAATGAAGAAGG + Intergenic
912681489 1:111732022-111732044 CTGAAGGGCAAGAAGGCAGCTGG + Intronic
912938348 1:114023393-114023415 CTGGAAAGGAAAAGGGAAGATGG - Intergenic
912977901 1:114346394-114346416 CTGGAGAGGAATCTGGAAGAAGG - Intergenic
913008868 1:114662964-114662986 AGGAAAAGGAAGAAGGAAGAGGG + Intronic
913293638 1:117298173-117298195 CTGAAGAGGTAAACTGAAGAGGG - Intergenic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
913705414 1:121417036-121417058 GTGAGGTGGAAGAAGGAAGACGG - Intergenic
913996523 1:143655214-143655236 AGGAAGAGGAAGGAGGAGGAGGG - Intergenic
914317532 1:146528194-146528216 CTGGAGAGGAGGAAGGATCAAGG + Intergenic
914496824 1:148205166-148205188 CTGGAGAGGAGGAAGGATCAAGG - Intergenic
914902644 1:151719380-151719402 CTGCAGAGGAATAAAAAAGAGGG - Intronic
915103330 1:153516102-153516124 CTGAAGAGGAAGCTGGGAGAAGG - Intergenic
915565291 1:156709566-156709588 CTGAAGTGCAAGCAGGGAGAAGG + Intergenic
915605309 1:156946788-156946810 CTGAAGAGGCAGAATGGACACGG + Intronic
916346546 1:163798050-163798072 TTGAAGAACAGGAAGGAAGAAGG - Intergenic
916602385 1:166305840-166305862 CTGAAGAGGAGCAAAGAAGTGGG + Intergenic
916616378 1:166445534-166445556 TAGAAGAAGAAGAAGGAAGGAGG + Intergenic
916819185 1:168381564-168381586 CTGAAGTTGAAGAAGGATGAAGG + Intergenic
916882338 1:169032051-169032073 GAGAAGAAGAAGAAGAAAGAAGG - Intergenic
917039800 1:170792265-170792287 GTGAATAGAAAGAAGGAATAAGG + Intergenic
917176697 1:172243468-172243490 CTGAAGAGGAGGTAGGAACCAGG + Intronic
917518100 1:175724877-175724899 GGGGAGAGGAAGAAGGAAAAAGG + Intronic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
918151130 1:181798920-181798942 AGGAAGAGGGAAAAGGAAGATGG + Exonic
918219719 1:182425945-182425967 CTGAAAAAGAAAAAGAAAGAAGG + Intergenic
919001029 1:191831729-191831751 CTTAAGAGGATGCAGTAAGAAGG - Intergenic
919434832 1:197544977-197544999 AGGAAGGGGAAGAAGGAAGAAGG + Intronic
919678425 1:200409732-200409754 AGGAGGAGGAAGAGGGAAGAGGG + Intronic
919862944 1:201754328-201754350 CAGAGGAGGAAGAAGGAATCTGG + Intronic
919913548 1:202126644-202126666 CCAAAGAGCAGGAAGGAAGAGGG - Intronic
920037155 1:203073691-203073713 CTCAAGGGAAATAAGGAAGAGGG + Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920127113 1:203702144-203702166 AGGAAAAGGGAGAAGGAAGATGG - Intronic
920612861 1:207458631-207458653 CTGAAGGACAAGAAGGAAGAAGG - Intronic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921359783 1:214320040-214320062 CAGAAAAGAAAGAAGGAAGGAGG + Intronic
921466904 1:215499221-215499243 CTGAATGGGAAGAGGAAAGAGGG + Intergenic
921582900 1:216915442-216915464 GTGGAGAGGAAGAAGGGAGAAGG + Intronic
921636430 1:217500278-217500300 CTGAAGAGGAGGGAGGAGTAAGG - Intronic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
921924069 1:220697406-220697428 CTGGCGAGGAAGGAGGAAGAAGG + Exonic
922010154 1:221575365-221575387 AGGAAGAGGAAGAAAGAAGGTGG + Intergenic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
922408115 1:225339895-225339917 CAGAGGAGGAAGAGGGAAGCTGG - Intronic
922561293 1:226571621-226571643 AAGAAGAAGAAGAAGGGAGAAGG - Intronic
922738528 1:228002972-228002994 CTGAGGAGGAAGACAGAAGCGGG + Intergenic
923031232 1:230250434-230250456 CTAAAGAGGCAGAAAGAAGAGGG - Intronic
923051334 1:230393142-230393164 AAGAAGAGGAGGAAGGAAAAAGG + Intronic
923232460 1:231999734-231999756 CTGAAGGGGCAGAAGGCAGAAGG - Intronic
923263651 1:232291488-232291510 CTGAGAAGGAAGATGGAAGAAGG + Intergenic
923378668 1:233392609-233392631 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
923676654 1:236086343-236086365 CTTAAGAGGGAGGAGCAAGATGG - Intergenic
923699695 1:236288159-236288181 CTGACAAAGAAGAGGGAAGATGG - Intergenic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923784965 1:237057625-237057647 CTGAAGAGGAAGAGAGGAGGTGG + Intronic
923999813 1:239538064-239538086 CAGAAGAGAAAAAAGGAAGAAGG + Intronic
924107899 1:240667700-240667722 GTGAAGACGAAGAATGAAGAGGG - Intergenic
924260974 1:242231217-242231239 AGGAAGAGGGAGGAGGAAGAGGG - Intronic
924260978 1:242231230-242231252 CTCAACAGGGAGGAGGAAGAGGG - Intronic
924467423 1:244311198-244311220 AGGAGGAGGAAGAGGGAAGAGGG - Intergenic
924680571 1:246227631-246227653 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1063029355 10:2216712-2216734 CTGAATATGAAAAATGAAGATGG + Intergenic
1063034225 10:2269319-2269341 CTGAAGAGGAAGAAGCCATGTGG + Intergenic
1063268408 10:4479493-4479515 CTGAAAAGGGAGATGGATGAGGG + Intergenic
1063912180 10:10841710-10841732 CTGAAGAGGAAAAACAAATATGG - Intergenic
1063945426 10:11171520-11171542 ATGAACAGGAAGAAGGAAACAGG + Intronic
1064686510 10:17867298-17867320 GGAAGGAGGAAGAAGGAAGAAGG - Intronic
1064686512 10:17867312-17867334 AAGAAGAAGAAGAAGGAAGGAGG - Intronic
1064710299 10:18116571-18116593 TTGAACAGGAAGAAGGTATAAGG - Intergenic
1064748159 10:18498332-18498354 CTAAAGTGGGAAAAGGAAGAGGG - Intronic
1064884555 10:20096040-20096062 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1065228502 10:23572147-23572169 CAGAAGAGAAAAAAGGAAAAAGG + Intergenic
1065261280 10:23926113-23926135 CTCAGGAAAAAGAAGGAAGAAGG + Intronic
1065508888 10:26457640-26457662 CTGAAGAGGAGGCTGGAAGGAGG + Intronic
1065818490 10:29503898-29503920 CTGAAGGGGAAGAAAAAAGTTGG + Intronic
1065885481 10:30073158-30073180 CAGAAGAGGAAGAAGTACGTAGG + Intronic
1065954430 10:30680601-30680623 CTGAAGGGGAAGAAAAAAGTTGG - Intergenic
1066130062 10:32384510-32384532 CTGAACAGAAAGAAGAAAGCTGG + Intergenic
1066412574 10:35187899-35187921 CTCAAGAGGAAGAGTGGAGAAGG - Intronic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066573106 10:36794488-36794510 GTGAAGAGGAAGCAAGGAGAAGG + Intergenic
1067182135 10:43996322-43996344 CAGAAGAGGGTGCAGGAAGAGGG + Intergenic
1067334851 10:45352363-45352385 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1067394613 10:45903039-45903061 GTGAAGGGGGAGAAGAAAGATGG + Intergenic
1067555202 10:47264806-47264828 CTGAAGAGGAAGGACGAAGCCGG + Intergenic
1067862936 10:49872170-49872192 GTGAAGGGGGAGAAGAAAGATGG + Intronic
1068068873 10:52170186-52170208 CTGAGGACAAAGAAGAAAGAAGG + Intronic
1068165016 10:53319086-53319108 ATGAAGAGGAAGAAGGAAAAAGG + Intergenic
1068225910 10:54107020-54107042 TAGATGAGAAAGAAGGAAGAAGG - Intronic
1068412669 10:56677750-56677772 AGGAGGAGGAAGCAGGAAGAAGG + Intergenic
1068909560 10:62364447-62364469 CTGAAGAGGAAGAGCAAAGCTGG + Intergenic
1069248053 10:66232616-66232638 CTGAATAGGAAGAACAAAGGAGG + Intronic
1069255211 10:66323869-66323891 CAGCAGAGAAAGAGGGAAGAGGG + Intronic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1069671847 10:70212689-70212711 CTGGAGAGGAGGAGGGAATAGGG + Intronic
1069965121 10:72108842-72108864 CTTAAAAGAAAAAAGGAAGAAGG + Intronic
1070102091 10:73398105-73398127 ATGAAGAGGATAAAGGGAGAAGG + Intronic
1070342938 10:75514295-75514317 AAGAAGAAGAAGAAGGAAAAAGG - Intronic
1070974965 10:80599274-80599296 CTGAAGGAGAAGACAGAAGAAGG + Intronic
1070988233 10:80707130-80707152 CTTAAGAGGTAGAAGTAACATGG - Intergenic
1071405925 10:85332414-85332436 CAGAAAAGGAAGAAGGCAGAGGG - Intergenic
1071519117 10:86318125-86318147 CTGAAGAGGAGGCAGGCAGTGGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071885439 10:89944695-89944717 CAGATGAGGAAGAAAGAAAAGGG - Intergenic
1071920739 10:90347194-90347216 CAGACAAGGAAGAAGGAACAAGG + Intergenic
1073115196 10:101087877-101087899 GTGGAGAGGAAGGAGGGAGAGGG - Intergenic
1073115225 10:101087994-101088016 AGGAAAAGGAAGGAGGAAGACGG + Intergenic
1073584096 10:104692165-104692187 CTGAGAAGGAAGGAGGAAAAAGG - Intronic
1073908091 10:108307865-108307887 CAGAAAAGAAAAAAGGAAGATGG + Intergenic
1073925872 10:108514563-108514585 CTGAAGGGGATGAGGGAAAATGG - Intergenic
1073959633 10:108911927-108911949 GTGGAGAGGAAGAAGGGAGCAGG - Intergenic
1074054706 10:109912218-109912240 AGGATGAGGAAGTAGGAAGAGGG - Intronic
1074078681 10:110151319-110151341 CTGAGGAGGAAGAAGAACCATGG + Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074257933 10:111821920-111821942 CTGAAGATGAGGGTGGAAGATGG - Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074410665 10:113225739-113225761 GTGGAGTGGAGGAAGGAAGAGGG + Intergenic
1074615892 10:115067866-115067888 CAGAAAAGAAGGAAGGAAGAAGG + Intergenic
1074722514 10:116274490-116274512 AAGAAGAGGAGGAAGGAGGAGGG + Intergenic
1074732161 10:116390746-116390768 AGGAGGAGGAAGAAGGAAGAAGG + Intergenic
1074852489 10:117449847-117449869 CTAAACAGGAAAAAGGAGGAAGG + Intergenic
1074987195 10:118668939-118668961 CAGATGAGGAAGAAGGAGGGTGG + Intergenic
1075074629 10:119342703-119342725 CTGGCCTGGAAGAAGGAAGAGGG - Intronic
1075155798 10:119974930-119974952 CTGATGAGGTAGAAGCAAGATGG + Intergenic
1075888199 10:125920978-125921000 CCGGAGAGGAAGCAGGAAGGTGG - Intronic
1076068176 10:127465121-127465143 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1076168722 10:128302826-128302848 CTATAGAGGAAGAAAGTAGAGGG - Intergenic
1076235078 10:128857773-128857795 GTGAAGAGGAAGAAAGAAAGAGG - Intergenic
1076382191 10:130031635-130031657 GTGAAGAGGAAGAAGGCATGTGG + Intergenic
1076408110 10:130226784-130226806 CAGCAGGGGAGGAAGGAAGATGG + Intergenic
1076468703 10:130703792-130703814 GGGAAGAGAAAGAAGGATGAGGG - Intergenic
1076558756 10:131347220-131347242 GAGATAAGGAAGAAGGAAGAAGG - Intergenic
1076923923 10:133471755-133471777 CTGGAGAGGAAAATGGCAGAGGG + Intergenic
1076924115 10:133473127-133473149 CAAAAGAGGAACAAGAAAGAGGG - Intergenic
1076987053 11:245486-245508 TTTAGGAGGCAGAAGGAAGATGG - Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077671500 11:4161832-4161854 CTGAAGATGAAGAAAGATGGGGG + Intergenic
1078030831 11:7749444-7749466 CCCAAGAGAAAGGAGGAAGAAGG + Intergenic
1078168218 11:8909376-8909398 AAAAAGAAGAAGAAGGAAGAAGG + Intronic
1078727512 11:13944849-13944871 CAGAAGAGTTAGAGGGAAGAAGG + Intergenic
1079016242 11:16871183-16871205 CTAAAGAGAAAGAGAGAAGATGG + Intronic
1079259359 11:18863600-18863622 CTGAGGTGGAAGAAGGCAGATGG - Intergenic
1079645156 11:22853703-22853725 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1079679507 11:23276616-23276638 CTAAAGAAGAAGAATGAAAATGG + Intergenic
1079932949 11:26587596-26587618 CTGAAAAGAAAGCAGGAAGATGG - Intronic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080288541 11:30644340-30644362 CTGAAAAGAAACAAGAAAGATGG + Intergenic
1080426728 11:32161754-32161776 CTGATGATTAAGAAGGAAAATGG - Intergenic
1080569361 11:33542292-33542314 ATGAAGAGGATGGAGGTAGAGGG - Exonic
1080570828 11:33555360-33555382 TTGAAAAGGAAGAACGAAGTTGG + Intronic
1080760501 11:35244544-35244566 TTGCAAAGGAAGAAGGAAGGGGG - Intergenic
1080785908 11:35474852-35474874 ATGAATAGGGAAAAGGAAGAAGG + Intronic
1080830862 11:35892189-35892211 CTACAGAGCAAGATGGAAGAGGG - Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1081147691 11:39583424-39583446 CTAAGGAGGAAGAAGTAATAGGG + Intergenic
1081246927 11:40778624-40778646 CGGTAGAGGAGGAAGGAAAAAGG + Intronic
1081503985 11:43695708-43695730 ATGATGAGGAAGGAGGAAAATGG + Intronic
1081928910 11:46854280-46854302 CCAAAGAGGAAGGAGGGAGAAGG + Intergenic
1082095220 11:48124463-48124485 ATGAACAGAAAGAAGCAAGAGGG - Intronic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082809210 11:57468423-57468445 CAGAAGAGGCAGAAGACAGATGG - Intronic
1082910486 11:58368289-58368311 CTAAAGGCGAAGGAGGAAGATGG - Intergenic
1083001808 11:59299109-59299131 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1083144117 11:60745734-60745756 CAGAAAAGGAAGAAGATAGAGGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083616348 11:64028420-64028442 CTGCAGAGGGAGGAGGGAGAGGG + Intronic
1083762008 11:64823866-64823888 GTGCAGAGGAAGAGGGGAGAGGG - Exonic
1084096674 11:66915862-66915884 CTGTAAAGGACGAAGAAAGAAGG - Intronic
1084100904 11:66948389-66948411 CTGAAGAGTGAGGAGGCAGAGGG + Intronic
1084463241 11:69307838-69307860 CTGAGCTGGGAGAAGGAAGATGG - Intronic
1084523987 11:69684666-69684688 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1084589075 11:70079648-70079670 CTGCATGGGAAGAAGGTAGAAGG - Intronic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1085171743 11:74455558-74455580 TTGAAGAGGAAAACGGATGAGGG + Exonic
1085186229 11:74578365-74578387 CTGAAGAGGAAGGTGGAAGAAGG + Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085405556 11:76259746-76259768 AGGAAGAGGAAGAAGGAATCTGG + Intergenic
1085446146 11:76602567-76602589 CAGGAGGGGAGGAAGGAAGAGGG - Intergenic
1085522365 11:77146146-77146168 CTAAGGAGAAAGAAGGTAGAGGG + Intronic
1085807649 11:79650997-79651019 AGAATGAGGAAGAAGGAAGAAGG - Intergenic
1085807655 11:79651032-79651054 AGGAAGAAGAAGAAGGAAGGAGG - Intergenic
1085807659 11:79651055-79651077 AGGAAGGAGAAGAAGGAAGATGG - Intergenic
1085807669 11:79651112-79651134 AGGAAGAAGAAGAAGAAAGAAGG - Intergenic
1085925827 11:81019336-81019358 AGGGAGAGGAAGAAGGAAGGAGG - Intergenic
1085999637 11:81966442-81966464 CTGAACTTGAAGATGGAAGAAGG + Intergenic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086457076 11:86969537-86969559 TTGAAAAGGAAGAAGGAGAAAGG - Intergenic
1086490202 11:87351914-87351936 CCAAAGAGGAAGAAAGAGGAAGG - Intergenic
1086507574 11:87521946-87521968 CAGAAGAGGAAGACAGAAGAAGG + Intergenic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1086917366 11:92546480-92546502 ATGAGGAGAAAGAAGTAAGAAGG + Intronic
1087306512 11:96495851-96495873 CTGAAGAGGAAAAAATAAAATGG - Intronic
1087327279 11:96739032-96739054 CTGAAGAGGGAGGCTGAAGAGGG - Intergenic
1087461410 11:98453417-98453439 CGGGGGAGCAAGAAGGAAGATGG + Intergenic
1087583583 11:100090575-100090597 CTGATGTGAAAGAAGGAAGGAGG - Intronic
1087600871 11:100313780-100313802 CTGAAGAGGAAGAATCAGCAAGG + Intronic
1087732074 11:101790223-101790245 AAGAAGAGGAAGAAGGAGAAAGG + Intronic
1087788441 11:102381859-102381881 CCAAAGAGAAAGAAGAAAGAAGG - Intergenic
1087838256 11:102896421-102896443 CTGGAGAGGATGTGGGAAGAGGG - Intergenic
1087968402 11:104448773-104448795 AAGGAGAGGAAAAAGGAAGATGG + Intergenic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1088277358 11:108101884-108101906 TCAGAGAGGAAGAAGGAAGAAGG - Intronic
1088300185 11:108349948-108349970 CTGGAGAGGAAGGAGTATGAGGG + Intronic
1088466745 11:110147803-110147825 ATGATGAAGAAGAAGGAACAAGG - Intronic
1088544024 11:110941928-110941950 CTGAGGAGGAGGAAGGGAGGGGG + Intergenic
1088760116 11:112921611-112921633 ATGAAGAGGAATAAGCATGAAGG - Intergenic
1088763154 11:112950958-112950980 AGGAAGAGGAGGAAGCAAGAAGG - Intergenic
1088907267 11:114164258-114164280 CGAGAGAGGGAGAAGGAAGAAGG - Intronic
1088935807 11:114399544-114399566 GTGAAGGGGGAGATGGAAGATGG + Intronic
1089028709 11:115299701-115299723 CTTAAGAAGCAGAAGCAAGACGG + Intronic
1089126760 11:116181602-116181624 GGGAAGGGGAAGAAGGAACATGG + Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089391476 11:118104853-118104875 AGGAAGAGGAGGAAGGAGGAAGG - Intronic
1089883981 11:121801610-121801632 AGGAAGAGGAAGGAAGAAGAAGG + Intergenic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1089995581 11:122903974-122903996 TGGAAGAGTAAGAAGGAGGAAGG + Exonic
1090044433 11:123318356-123318378 AGGAAGAGGAAGAGGGAAAATGG + Intergenic
1090305941 11:125691195-125691217 GTGAAGAGGAAGAAGAGAGAGGG - Intergenic
1090430908 11:126645630-126645652 CTGAAGAAGAAAAGGTAAGAAGG + Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090493795 11:127190343-127190365 GTGAAGAGTAAAAAAGAAGATGG + Intergenic
1090507316 11:127331415-127331437 AAGAGGAGGAAGAAGGAAAAAGG + Intergenic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1090697568 11:129263641-129263663 GGGAGGAGAAAGAAGGAAGAAGG + Intronic
1090717769 11:129445252-129445274 CTGACGAGGAAGAAGGTGGGTGG - Intronic
1090933333 11:131319412-131319434 ATGAAGAGGAAGGAGAAGGAGGG - Intergenic
1090989969 11:131808209-131808231 CTTAAGAGGAGGAAGGCAGTAGG + Intronic
1091067372 11:132528569-132528591 CTTGAGTGGAAGAAGGATGATGG - Intronic
1091158196 11:133393715-133393737 CTGAAGATGATGAAGGAAATTGG - Intronic
1091164885 11:133466774-133466796 GTGAAGAGGAAGAAAGAAGAAGG + Intronic
1091467527 12:698217-698239 CAGAAGAGGACAAAGGAAGGAGG - Intergenic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1091856713 12:3746417-3746439 TGGGAGAGGAAGAAGGGAGAGGG - Intronic
1092188772 12:6502087-6502109 CTGATGCTGCAGAAGGAAGAGGG + Intronic
1092284079 12:7118923-7118945 AGGAGGAGGAAGAAGAAAGATGG + Intergenic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092314826 12:7399474-7399496 AGGAAGAGGAAGAAGAAGGAAGG - Intronic
1092358485 12:7816531-7816553 GTGAAGAAGAAAAAAGAAGATGG - Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092490895 12:8943911-8943933 CTGAGGAGGGACAAGGAAAATGG + Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1093202793 12:16209783-16209805 CTAGAGAGGAAGTAGGCAGATGG - Intronic
1093228049 12:16509315-16509337 ATGAAAAGGAAGAAGAAATATGG - Intronic
1093492552 12:19721823-19721845 GGGAAGAAGAAGAGGGAAGAAGG - Intergenic
1093531957 12:20176079-20176101 TTGGGGAGGAAGAAGGATGAAGG - Intergenic
1093578011 12:20757148-20757170 ATAAAGAGGGAGATGGAAGAGGG - Intergenic
1093622742 12:21311923-21311945 CTCAAAAAGAAGAAAGAAGAAGG + Intronic
1093670417 12:21867781-21867803 CTGAAGAGGAGGATGGTTGATGG + Intronic
1093687024 12:22068398-22068420 AAGAAGAGGAAGAAAGATGAGGG + Intronic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1093755277 12:22845558-22845580 AAGAAGAGGAAGAGGAAAGAAGG - Intergenic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1094070293 12:26405146-26405168 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094179614 12:27577957-27577979 TGGACGGGGAAGAAGGAAGAAGG + Intronic
1094337138 12:29372379-29372401 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094411004 12:30169173-30169195 CTGAACAGAAGGAAGGAAGACGG + Intergenic
1094432211 12:30381759-30381781 TTGAAGAAGAAGAACAAAGATGG + Intergenic
1094522629 12:31208946-31208968 CTGTAGAGGATGAAGGAAGCAGG - Intergenic
1094628260 12:32146916-32146938 AGGAGGAGGAAGGAGGAAGAAGG - Intronic
1094651662 12:32384709-32384731 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1094782679 12:33810575-33810597 CTGAGAAGGAAAAAGGAATAGGG + Intergenic
1095133387 12:38569045-38569067 ACAAAGAGGAAGAAGGAAGGAGG - Intergenic
1095358515 12:41306466-41306488 CTGAAGGGGATGGAGGGAGATGG - Intronic
1095359140 12:41314579-41314601 TCCAAAAGGAAGAAGGAAGAGGG + Intronic
1095366392 12:41411348-41411370 GTGAAAAGGAAGGAGAAAGATGG + Intronic
1095521405 12:43071096-43071118 GTGAGGAGGAAGCAGAAAGAAGG - Intergenic
1095634295 12:44414268-44414290 CTGAAGAGGAAGCACAAAGTTGG + Intergenic
1095683394 12:45004592-45004614 ATGAAAAGTAAGAAAGAAGATGG - Intergenic
1095740688 12:45603495-45603517 AAAAAGAAGAAGAAGGAAGAAGG - Intergenic
1096213066 12:49781198-49781220 CTGAAAAGAAGGAAGGAAGGAGG - Intergenic
1096247035 12:49996811-49996833 GGGAAGAGCAAGAAGGAAAAAGG + Intronic
1096542049 12:52313405-52313427 GTGAAGGGGAGGAATGAAGAGGG + Intergenic
1096558707 12:52420296-52420318 TTGAAAAGGAAGAAGGCACAGGG - Intergenic
1096619038 12:52850948-52850970 CTCAAGAGGAAGAAGAGACAGGG + Intergenic
1096629693 12:52918113-52918135 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
1096682770 12:53268028-53268050 CTGAAGATAAAGGAGGAAAAGGG + Intergenic
1096709918 12:53447881-53447903 TTGAGGAGGAACAGGGAAGAAGG + Intergenic
1096848768 12:54422022-54422044 ATGGAGAGGAAGAAGGGTGAAGG + Intergenic
1097061006 12:56283858-56283880 CTAAAGAGGATGAAGAAAGAAGG + Intronic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097336605 12:58390675-58390697 CTGAGGAGAAACATGGAAGAGGG - Intergenic
1098096600 12:66963480-66963502 ATGAAGAAAAAGAAGGAATAAGG + Intergenic
1098141468 12:67454004-67454026 CTAAAGAGGAATAGGAAAGAAGG + Intergenic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098276285 12:68814930-68814952 CTGGAGAGGAAAAAGAAAAATGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098558157 12:71842511-71842533 GTGAAGAGGAAGAAGCAAGAAGG + Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098986956 12:77022933-77022955 CAGAAGAGTAAGAGGGAAAATGG - Exonic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099424859 12:82511032-82511054 CTAAAGATGAAGGAGGAAGATGG - Intergenic
1099493076 12:83309587-83309609 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1099553110 12:84073005-84073027 CTGAAGACCAAGAAAGAAGTAGG + Intergenic
1099645212 12:85344409-85344431 CGGAAGAGAAACAAGGAAGATGG + Intergenic
1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG + Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100169942 12:91963057-91963079 AAGAAGAGGATGAAGGAAGAAGG - Intergenic
1100229221 12:92590170-92590192 CTGGAGAGGAAGAAAGCACAGGG + Intergenic
1100245610 12:92753711-92753733 CTGGAGAGGCAGAAGGGAAAAGG - Intronic
1100465917 12:94845202-94845224 CTGAAGACGGAGAAGGGATACGG - Intergenic
1100673572 12:96842745-96842767 GAGAAGAGGAAAAAGGAGGAAGG - Intronic
1100877269 12:98975301-98975323 AGGAAAAGGAAGAAGGAAGGAGG - Intronic
1100879895 12:99004865-99004887 CTGAAGAGATAGAAGTGAGAGGG + Intronic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101575315 12:105991842-105991864 CTGAACAGGGAGTGGGAAGATGG - Intergenic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1101915029 12:108889446-108889468 CTGAAGAGGAAGGACAAAGGGGG - Intronic
1101962162 12:109258557-109258579 CTGCTGAGGAAGAAGCAAGATGG - Intronic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102167964 12:110821038-110821060 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1102558900 12:113748290-113748312 CTGAAGAGGGAGAAGAAACCTGG - Intergenic
1102560138 12:113756076-113756098 CTGACCTTGAAGAAGGAAGAAGG + Intergenic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1102759318 12:115371765-115371787 GGGAATAGGAAGGAGGAAGAAGG + Intergenic
1102767096 12:115443046-115443068 ATGGAGAGGAAAAAGGAACAGGG - Intergenic
1103022983 12:117551286-117551308 AGGAATAGGAAGAAGGAAGGAGG - Intronic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103091023 12:118098170-118098192 CAGAAGGGGTAGAAAGAAGAGGG + Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1104236906 12:126947692-126947714 GAGAAAAGGAAGAAGGAAGCTGG - Intergenic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104423905 12:128658932-128658954 CTGAAGAGGAGAAAGCAATAAGG + Intronic
1104715429 12:131013082-131013104 CTGAAGGGCAAGATTGAAGAAGG - Intronic
1104732657 12:131116570-131116592 CTCCAGAGGAAGGAGGAGGAGGG - Intronic
1104999883 12:132683361-132683383 CTGAAGATGAAGAAGCAGCAAGG + Intronic
1105450342 13:20493660-20493682 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1106042940 13:26111234-26111256 TAGAGGAGGAAGGAGGAAGAGGG - Intergenic
1106139759 13:27002332-27002354 CTGAAAGGGCAGAAGGGAGATGG + Intergenic
1106177355 13:27342643-27342665 CTGAAGTGGAGTAAGGAAAAGGG - Intergenic
1106294222 13:28395321-28395343 CTGAACAGGAAGAGAGAAGGTGG - Intronic
1106560438 13:30840939-30840961 CTGTGGAGGAACAATGAAGAAGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106976629 13:35225428-35225450 CTGTAGAGGAGATAGGAAGAAGG + Intronic
1107036116 13:35904555-35904577 CTGATAAGAAAGAAGGGAGATGG + Intronic
1107341722 13:39414360-39414382 GGAAAGAGGAAGATGGAAGATGG - Intronic
1107367287 13:39696355-39696377 CTGAAGAAAAAGCAGGAAAAAGG + Intronic
1107376466 13:39809984-39810006 TCGAAGAGGAAGAAGGAGGAGGG - Intergenic
1107448930 13:40491448-40491470 TAGAAGGGGAAGGAGGAAGAAGG - Intergenic
1107526109 13:41233280-41233302 GAGTAGAGGAAGTAGGAAGAGGG + Intronic
1107526788 13:41240572-41240594 CTGAAGAAGAAGAAGAAAAGAGG + Intronic
1107566920 13:41614371-41614393 CCGCAGAGGAAAAAGGAAGACGG + Intronic
1107851667 13:44577415-44577437 CGGAGGAGGAGGAGGGAAGATGG + Intergenic
1107925000 13:45250459-45250481 CTGAAGATGAACAAGGGTGATGG - Intronic
1108291034 13:48961370-48961392 GAGAAGAAGAAGGAGGAAGAGGG + Intergenic
1108308656 13:49164111-49164133 TTGAAGAGGAAGGAGAAATAAGG - Intronic
1109239671 13:59870415-59870437 CTGAAGAAGAAGAACTAAGTTGG - Intronic
1109260422 13:60138780-60138802 AAGAAGGGGAAGAGGGAAGAGGG + Intronic
1109476882 13:62891014-62891036 CTGGAGTGGAAGGAGGAACATGG + Intergenic
1109665140 13:65524796-65524818 TGGAAGAGGGAGAAGGAAGAGGG - Intergenic
1109807247 13:67459652-67459674 CAGAAGATGAAGAAGGAAATAGG + Intergenic
1109918825 13:69028228-69028250 CAGAAGAGGCAAAAGGAAGGGGG + Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1110278721 13:73668001-73668023 CGGAAGATAAAGAAGGAAGCAGG - Intergenic
1110311736 13:74057834-74057856 ATGAAGAGTAAGAAGGAAGGAGG + Intronic
1110548234 13:76781018-76781040 CTAAGGAGAAAGAAGGAATATGG + Intergenic
1110590091 13:77246478-77246500 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1110606970 13:77444051-77444073 GGGAAGAGAAAGAAAGAAGAGGG + Intergenic
1110649910 13:77932151-77932173 CGGAAGAGGAAGATGAAAGAGGG + Intergenic
1110670532 13:78171982-78172004 GTCAAGAGGAAGAAGGAAAAAGG + Intergenic
1110880510 13:80566561-80566583 CAGAAGAGGAAAAAGGCAAAAGG - Intergenic
1110909972 13:80947026-80947048 CTGCAGAGGAAGAAGAATGTGGG + Intergenic
1111424426 13:88060547-88060569 CAGAAGAAGAAAATGGAAGAGGG - Intergenic
1111495559 13:89044689-89044711 CTGAGGAGGAAGAGGAAAAAGGG + Intergenic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112698731 13:101979632-101979654 CTGAAGTTGAAGTAGAAAGAAGG + Intronic
1113043038 13:106125274-106125296 CTGGAGGGGAAGGAGGAAGAAGG - Intergenic
1113166288 13:107447220-107447242 GAGAAGGGGAAGAAAGAAGAAGG - Intronic
1113258607 13:108534782-108534804 AGGAAGAAGAAGAAGAAAGAAGG - Intergenic
1113294595 13:108944349-108944371 TTGAAGAGGAAAAGGGAAAAAGG + Intronic
1113900892 13:113797327-113797349 CTGCTGAGGAAGAAGACAGATGG + Intronic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1114038133 14:18648848-18648870 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1114200061 14:20511677-20511699 CTGTAGAGCAAGATAGAAGATGG + Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114552115 14:23538721-23538743 AAGAGGAGGAAGGAGGAAGAGGG + Intronic
1114552614 14:23542057-23542079 GAGAAGAGGAGGGAGGAAGAAGG + Intronic
1114556770 14:23566744-23566766 TTAAAGAGGAAGATGGAACAGGG - Intronic
1114974775 14:28081878-28081900 CTCAAGAGGAAAAAGTAAGAAGG - Intergenic
1115199424 14:30836871-30836893 CCGAAAAGAAAGAAAGAAGAAGG + Intergenic
1115521918 14:34241629-34241651 GTGAAGAGGAGGAAGGAATGGGG - Intronic
1115535564 14:34369724-34369746 AAGAAGAGGAAGAAAGAAAAAGG - Intronic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1116108647 14:40545858-40545880 CTGAAAAGCAAGAATGAAAAGGG + Intergenic
1116407715 14:44585544-44585566 ATGAAGAGGAAGAGGGTATATGG - Intergenic
1116879798 14:50154102-50154124 TGGAAGAGGAAGAAGGGAAAAGG + Intronic
1116966934 14:51024790-51024812 AAAAAGAGGAAGAAGGAACAAGG + Intronic
1117214965 14:53541553-53541575 GAGAAGAGAAAGAGGGAAGAGGG + Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117433810 14:55697454-55697476 CTGGAGAGGAAGCTGGAAGGCGG - Intronic
1117667831 14:58076037-58076059 AGAAAGAGGAAGAAAGAAGAAGG + Intronic
1117796449 14:59399032-59399054 CTGAAGAAAAGGGAGGAAGAGGG - Intergenic
1118033386 14:61839927-61839949 CAGAAGAGGAAGAAGGGAAAGGG + Intergenic
1118099726 14:62583471-62583493 CTGAAAAGAAAAAACGAAGATGG - Intergenic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118716948 14:68566853-68566875 TTGAAGAGTAATAAGAAAGAAGG - Intronic
1118837410 14:69486588-69486610 CTGCTGAGGCAGAAGAAAGATGG - Intronic
1118885993 14:69866237-69866259 CTGGAGAGGAAGAAGGACCCTGG - Intronic
1119036209 14:71231946-71231968 CAGCAGAGGAAGAAAGATGATGG + Intergenic
1119309410 14:73633893-73633915 CTGAAGAGGAGGGAGGAGGGGGG - Intergenic
1119535334 14:75398412-75398434 CAGAAAAGGAAAAGGGAAGAAGG + Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119672463 14:76530042-76530064 GTGAAGAGGAGGAAGGACGGGGG - Intergenic
1120439777 14:84521252-84521274 CTGCACAGGAATAAGGAAGAGGG + Intergenic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1120572048 14:86131101-86131123 ATGAAGAGGAATATGAAAGAAGG + Intergenic
1120882783 14:89427276-89427298 CACAAGAGGAGGAAGGAAAAGGG + Intronic
1121042310 14:90759114-90759136 CAGAAGAGCAGGAAGGAAGCTGG - Intronic
1121431026 14:93888602-93888624 CTGAAGGGCAAGGAGGAAGAGGG + Intergenic
1121735700 14:96216641-96216663 GAGAAGAGGAAGAAAGAAGGAGG + Intronic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121847365 14:97184745-97184767 CTGAAGAGAGAAAAGGAAAATGG + Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1122009094 14:98731015-98731037 CCAAAGAGCAAGAAGGAAGCTGG - Intergenic
1122128076 14:99589958-99589980 CTGAGCAGGAAGGAGGCAGAGGG - Intronic
1122392799 14:101401846-101401868 ACGAAGAAGAAGAGGGAAGAGGG - Intergenic
1122646207 14:103196109-103196131 CTGTAAAGGAAAAAGGAACAAGG + Intergenic
1122949471 14:105033721-105033743 GTGAAGGGGAAGGAGGAACAGGG - Intergenic
1123541141 15:21292836-21292858 CTGAAGGGGAAACAGGCAGAAGG + Intergenic
1123774089 15:23560768-23560790 CTGAAGAGGAAGGAGAAAATAGG + Intergenic
1123977608 15:25567966-25567988 CTGAAGAGGCAAAAGACAGATGG + Intergenic
1124216229 15:27808934-27808956 GTGAAGAGGAAGGAGAATGATGG - Intronic
1124624507 15:31300305-31300327 CTGACCAGGAAGAAGGCAGTGGG + Intergenic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1125135642 15:36338100-36338122 CTAAAGAGGAAGAACAAAGTTGG - Intergenic
1125341622 15:38681420-38681442 AGGAAGAGGAAGAAGGAAGAAGG - Intergenic
1125419412 15:39489117-39489139 CTAGTAAGGAAGAAGGAAGAAGG + Intergenic
1125684668 15:41556849-41556871 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1125971892 15:43918455-43918477 CAGAAAAGGAGGAGGGAAGAAGG - Intronic
1125975747 15:43950039-43950061 CTGCATACCAAGAAGGAAGAAGG - Intronic
1126187348 15:45843219-45843241 CTGAACAGCAAGCAGGCAGATGG - Intergenic
1126195852 15:45930423-45930445 CAGAAGAGGAAAGAGAAAGAAGG - Intergenic
1126240858 15:46441595-46441617 GTGGAGAGGAAGAAGGCAAAGGG + Intergenic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1126405679 15:48320310-48320332 TTGGCGAGGAAGACGGAAGAAGG + Intergenic
1126570043 15:50141090-50141112 GGAAAGAGGAACAAGGAAGATGG - Intronic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1127122101 15:55780573-55780595 CAGAAGAAGAAGAAGAAAGGAGG + Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127244929 15:57162806-57162828 TTGAAGTGGAAAAAGGAACAAGG - Intronic
1127249451 15:57215917-57215939 CAGAAAAGTAAGATGGAAGAGGG + Intronic
1127462741 15:59214196-59214218 TAGAATAGGATGAAGGAAGAGGG + Intronic
1127664654 15:61133834-61133856 CTGATGATGCAGTAGGAAGAAGG - Intronic
1127691077 15:61398482-61398504 TTGAGGAGGAAGAAGGTAGGAGG + Intergenic
1127698401 15:61473774-61473796 CAGGAGAGAAAGAAGGAAGGAGG + Intergenic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1128095574 15:64951676-64951698 AAGAAGAGGAAGAAGAAAGAAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128143585 15:65319175-65319197 AAGAAGAGGAAAAAGAAAGAAGG - Intergenic
1128154286 15:65383077-65383099 GTGAAGAGGAGGCAGGAGGATGG + Exonic
1128271828 15:66316958-66316980 ATGAAGAGGAAAATGGCAGAAGG - Intronic
1128619826 15:69139322-69139344 CTGAAGATGAAGCAAGAAGCAGG - Intergenic
1128726800 15:69993977-69993999 CTGAGGAGGAAGAAGGAGAGGGG - Intergenic
1128871843 15:71165101-71165123 CAGAAGAGGAAGAAGGCCGAAGG + Intronic
1128919058 15:71593980-71594002 CTGATGAGAAAGAGGGAAGAGGG + Intronic
1129011357 15:72420771-72420793 CTGAAGCAGAATGAGGAAGAGGG - Intergenic
1129180959 15:73875263-73875285 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129683436 15:77671291-77671313 GAGAAGAGGGAGAAGGTAGAGGG + Intronic
1129978294 15:79842288-79842310 CTGAAGAAGAATTAGGAAGGAGG + Intronic
1130223507 15:82041169-82041191 GGGAAGCCGAAGAAGGAAGAAGG - Intergenic
1130691498 15:86085354-86085376 ATGAAGGGGAAGAAATAAGATGG + Intergenic
1130772971 15:86943659-86943681 GTGATGAAGAAAAAGGAAGAGGG + Intronic
1130897865 15:88184638-88184660 CTGAATAGGAAAAAGAAAGAAGG - Intronic
1131025222 15:89135873-89135895 CAGAACAGGAAGAAGGCCGAAGG + Intronic
1131040014 15:89255836-89255858 CATAAGTGGAAGGAGGAAGAAGG + Intronic
1131110165 15:89759952-89759974 ATAAAGAAGAAGAAGAAAGATGG + Intergenic
1131139816 15:89968077-89968099 ATGATGATGAAGAAAGAAGAGGG + Intergenic
1131432882 15:92400781-92400803 CTGAAGGGGATTAAGGTAGACGG - Intronic
1131667387 15:94585079-94585101 GTTTGGAGGAAGAAGGAAGAGGG - Intergenic
1131734618 15:95318920-95318942 CTACAGAGGAAGAAGGTACAAGG - Intergenic
1131955463 15:97730533-97730555 CTGAAGGAGAAGCAAGAAGAAGG + Intergenic
1132149971 15:99452343-99452365 ATGATGAGGAAGAAGGGAGGTGG + Intergenic
1202949454 15_KI270727v1_random:19977-19999 CTGAAGGGGAAACAGGCAGAAGG + Intergenic
1132795492 16:1719441-1719463 TTGAAAAGGAAGATGTAAGAGGG + Intronic
1132949694 16:2554222-2554244 CTGAAGAGGAGGCAGGAGCAAGG + Intronic
1132964654 16:2645945-2645967 CTGAAGAGGAGGCAGGAGCACGG - Intergenic
1133385682 16:5368418-5368440 CTGAAGAAAAACAAGGAAGTGGG - Intergenic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133436427 16:5784123-5784145 GTGAAGAGGAAGCAGGCAGCCGG + Intergenic
1133460690 16:5984021-5984043 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1133626563 16:7575443-7575465 TTTAAGAAGAAAAAGGAAGAGGG + Intronic
1133668851 16:7997981-7998003 CTGTAGTGGAAAATGGAAGAGGG - Intergenic
1133826786 16:9285001-9285023 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1133890884 16:9877677-9877699 CTGAAGAGGGGGAAGAGAGAGGG - Intronic
1134060021 16:11193775-11193797 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1134102345 16:11461092-11461114 CTGGAGAGGAAGGAGGAGAATGG - Exonic
1134111015 16:11515700-11515722 CTGAGGAGGGAGGAGGAAGGAGG + Intronic
1134125246 16:11612043-11612065 CCCGAGGGGAAGAAGGAAGAAGG - Intronic
1134238489 16:12486429-12486451 AGGACAAGGAAGAAGGAAGAAGG - Intronic
1134287165 16:12871984-12872006 GGGAGGAGGAAGAAGGAGGAAGG - Intergenic
1134355017 16:13474187-13474209 CTGTAGAGGAAAGAAGAAGAGGG - Intergenic
1134410342 16:13998684-13998706 AAGAAGAGGAAGAGGGAAGAAGG + Intergenic
1134555689 16:15162068-15162090 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134916271 16:18073779-18073801 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1135232054 16:20717812-20717834 AAGAAGAAGAGGAAGGAAGAAGG + Intronic
1135511289 16:23086093-23086115 CTTTGGAGGAAGGAGGAAGAAGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1135972226 16:27080857-27080879 CTGAAGAGAGAGAAGGAAAAGGG - Intergenic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1136360282 16:29775013-29775035 AAGAAGAGGCAGAAGGAAAAAGG + Intergenic
1136451053 16:30354534-30354556 CTGAAGAGGAAGAAAGCTGGCGG - Intronic
1136468809 16:30464538-30464560 CTGAAGGGGTTGAACGAAGAGGG - Intergenic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136539119 16:30918826-30918848 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1136663933 16:31791830-31791852 CTGAAGGGGAATGAGGTAGAGGG + Intronic
1137530599 16:49276562-49276584 AAGAAGAGGGAGAAAGAAGAGGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137990820 16:53153229-53153251 GTAAAGAGGAAGAAAGAAGGGGG + Intronic
1138038522 16:53634114-53634136 CTGAAGAGGATGCAGCAACAAGG - Intronic
1138298722 16:55908920-55908942 ATGGAGAGAAAGGAGGAAGAAGG - Intronic
1138318620 16:56091712-56091734 TTGAACAGGGAGAAGGAAGGAGG - Intergenic
1138321211 16:56113630-56113652 CTGAAGAGGCAGAATCATGAAGG - Intergenic
1138470752 16:57233889-57233911 CTGGGGAGGAACAAGGTAGAGGG - Intronic
1138491722 16:57381029-57381051 ATGAAGGGGAAGAAGGAAGTTGG + Intronic
1138582083 16:57948296-57948318 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1138705165 16:58908201-58908223 CTGAAGAGAAAGAAAAAATAAGG - Intergenic
1138887651 16:61098901-61098923 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1138979955 16:62256042-62256064 CTGAAGATGGAAATGGAAGATGG - Intergenic
1139548596 16:67661235-67661257 CAGCAGTGGAGGAAGGAAGACGG - Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1140117124 16:72051644-72051666 CTCAAGAGGAGGTAGGAGGAAGG - Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140923184 16:79558284-79558306 ATAAAGAGAAAGAAGAAAGAAGG + Intergenic
1141198381 16:81878586-81878608 CTCAAGAGACAGTAGGAAGAAGG - Intronic
1141243325 16:82283490-82283512 AGGAAGAGGGAGAAGAAAGATGG + Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141845119 16:86603377-86603399 AGGAGGAGGAAGAAGGAGGAGGG - Intergenic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142312453 16:89321862-89321884 CTGAAGAGGAAGAGGAGAGATGG - Intronic
1142404910 16:89882970-89882992 TTGAGGAGAAAGGAGGAAGAAGG + Intronic
1142561300 17:811090-811112 CAGAAGAGGAAGAAAGAAGGAGG + Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142862304 17:2770140-2770162 CTGAAGAGGAGGCAGCTAGAAGG - Intergenic
1143270855 17:5673420-5673442 CTGGAGAGTGGGAAGGAAGAGGG + Intergenic
1143359972 17:6361537-6361559 CTGAAGAGGAATGAGGCACAGGG - Intergenic
1143361137 17:6372220-6372242 TGGAAGAGGGAGAAGGGAGAAGG + Intergenic
1143389624 17:6552580-6552602 CTGGAGCGGAAGAATGCAGAGGG - Intronic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1143542949 17:7580380-7580402 CTCAGAGGGAAGAAGGAAGAGGG + Intronic
1143656944 17:8300443-8300465 AGGAAGAAGAAGAAAGAAGAAGG - Intergenic
1143709814 17:8726562-8726584 GTGCAGAGGAAGGAGGCAGAGGG + Intergenic
1143794696 17:9327240-9327262 CAGAGGAGGAAGGAGGAAGGAGG + Intronic
1143794701 17:9327260-9327282 AGGAGGAGGAAGGAGGAAGAAGG + Intronic
1143794703 17:9327301-9327323 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1144233317 17:13231115-13231137 ATGAAGAGGGTGCAGGAAGAAGG - Intergenic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1145763284 17:27440334-27440356 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1145815153 17:27789848-27789870 GATAAGAGGAAGAGGGAAGATGG - Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146219725 17:31008163-31008185 TTGAACAGAAAGAAGGAACAAGG - Intergenic
1146322874 17:31859937-31859959 TTGAGGGGGATGAAGGAAGAGGG - Intergenic
1146551625 17:33785205-33785227 GTGAAGATGAAGAAAGAAGATGG + Intronic
1146645970 17:34577982-34578004 AGGAAGAGGAGGAAGGAAGCAGG - Intronic
1146749469 17:35365035-35365057 TTAAAGAGGTAGAAGGAAGTTGG + Intronic
1146987315 17:37232497-37232519 AGGGAGAGGAAGAAGGAAGGGGG + Intronic
1147302794 17:39543247-39543269 TTGATGAGGCAGAAGGAAGGTGG + Intronic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1147498812 17:40942527-40942549 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147498863 17:40942820-40942842 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147511875 17:41076884-41076906 AGGAAGAGAAGGAAGGAAGAAGG + Intergenic
1147559981 17:41502813-41502835 CTGAAATGCAAGCAGGAAGAAGG + Intronic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1147961644 17:44171112-44171134 CAGAAGAGGAGGGAGAAAGAAGG + Intronic
1148192608 17:45690134-45690156 CTGAAGGGGAAGGAGGAGGAAGG + Intergenic
1148356764 17:46980351-46980373 AAGAAGAGAAAGAAAGAAGAAGG - Intronic
1148477822 17:47940961-47940983 CTGAATGGGAAGGGGGAAGAAGG - Intergenic
1148546430 17:48522566-48522588 CTGGAGAGGATGAAGGAAAGGGG + Intergenic
1148668902 17:49395485-49395507 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1148744697 17:49911761-49911783 CTGGAGAGGAGGGAAGAAGAGGG + Intergenic
1149018760 17:51938719-51938741 GTAAAGAGAAAGGAGGAAGAGGG + Intronic
1149107116 17:52982691-52982713 AGGAAGAGGAAGAGGGAAGAAGG - Intergenic
1149276936 17:55051754-55051776 CTTAAAAGGAAAAAGAAAGAAGG + Intronic
1149383840 17:56122593-56122615 CTGAAGCAGAAGAAGGGAGTAGG - Intronic
1149595918 17:57864635-57864657 CTGCAGTGGATGAAGGAGGATGG + Intronic
1149600270 17:57888928-57888950 CAGGGGAGGAAGAAAGAAGATGG + Intronic
1149797902 17:59538387-59538409 AGGAAGAGGAAGAAGGAAGAAGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149987861 17:61361734-61361756 CTGAAGGTGAAGAACCAAGAAGG + Intronic
1150035057 17:61786128-61786150 GTGAAGAGAGAGAAGAAAGAAGG + Intronic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1150271920 17:63872391-63872413 CTGAAGGGGAGGGAGGAAAATGG - Intronic
1150275468 17:63895287-63895309 CTGAAGGGGAGGGAGGAAAATGG - Intronic
1150277601 17:63909976-63909998 CTGAAGGGGAAGGAGGAAAATGG - Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150425768 17:65075843-65075865 CAGAAGGGCAAGAAGGAAGCAGG - Intergenic
1150466879 17:65401013-65401035 ATGCAAAGAAAGAAGGAAGAAGG - Intergenic
1150475752 17:65473323-65473345 CTGAAGAGAAAGAAGGAATGGGG - Intergenic
1150605574 17:66687784-66687806 GAGAAGGGGAAGAAGGAAGGAGG + Intronic
1150815559 17:68389605-68389627 CTGAAGAAGAGGAAGGGACAGGG - Intronic
1150916284 17:69440452-69440474 TTGAAAAGGAAGAAGCCAGAGGG - Intronic
1150977233 17:70102184-70102206 GTGAACAAGAAGAAAGAAGAAGG - Intronic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151887525 17:76932007-76932029 AGGAGGAGGAAGAAGAAAGAAGG - Intronic
1151889713 17:76944865-76944887 CTGATGAGGAAGAAAGGAGGTGG + Intronic
1152053891 17:78006585-78006607 AGAAGGAGGAAGAAGGAAGAAGG - Intronic
1152053894 17:78006602-78006624 AGAAAGAAGAAGAAGGAAGAAGG - Intronic
1152566689 17:81103479-81103501 CTGAAGTGGAAGCAGCAGGAAGG - Intronic
1152783745 17:82237644-82237666 CTGAAGAGGTAGACGGAGTAGGG - Exonic
1152913076 17:83016603-83016625 CTGAAGAGGAGGGGGGAGGAGGG + Intronic
1153709187 18:7780753-7780775 CTGAAGAGGAATCAGGATAAGGG + Intronic
1153734942 18:8057168-8057190 TTGAATAGGAAGTAGGAAGGTGG + Intronic
1153794772 18:8611478-8611500 CAGAAGAGGAGAGAGGAAGAAGG + Intronic
1153809793 18:8741980-8742002 CTGAATAGGATCAAGGAAGCAGG - Intronic
1153822182 18:8841605-8841627 CTGAAGCAGAAAAAGGAATATGG - Intergenic
1154292866 18:13125759-13125781 GTGAAGTGGAAGAAGAAAAAAGG - Intergenic
1155030331 18:21978631-21978653 CTTGAGAGGAAGTTGGAAGAGGG - Intergenic
1155066566 18:22273843-22273865 GGGAAGAGGAGGAGGGAAGAGGG - Intergenic
1155201575 18:23522543-23522565 CTTAAGAGGAAGAAGAAGAATGG - Intronic
1155472785 18:26208338-26208360 CTGAAGAAAAAGAAGGGAGTGGG + Intergenic
1156048042 18:32898826-32898848 CTGTACAGGAAGAAAGAAGCTGG - Intergenic
1156358711 18:36364887-36364909 CTGAAGGGGGAGAAAGCAGAAGG + Intronic
1156540122 18:37901423-37901445 CTGCATTGGAAGAAGGAAGGTGG - Intergenic
1157085196 18:44573400-44573422 AGGAAGGGGAAGAAGGAAGACGG + Intergenic
1157246012 18:46056059-46056081 CTGTAGAGAGAGAAGGGAGAGGG - Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157583177 18:48785106-48785128 AAGAGAAGGAAGAAGGAAGATGG - Intronic
1157895598 18:51463941-51463963 GTGAAGAGGAAGAATGCAGGAGG - Intergenic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158731068 18:60022962-60022984 TTTAAGAAGAAGAAGCAAGAAGG + Intergenic
1158835882 18:61331729-61331751 GTGAAGGAGAAGGAGGAAGAGGG - Intergenic
1159060171 18:63506314-63506336 ATGAGGAGGAAGATGAAAGAGGG + Intergenic
1159488839 18:69102868-69102890 CTAAACAGGAAGAGAGAAGAGGG - Intergenic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1159745919 18:72234489-72234511 CGGATGAGAAGGAAGGAAGATGG - Intergenic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1160013827 18:75125915-75125937 CTGCAGAGGGAGGAGGAACAGGG - Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160448662 18:78947074-78947096 AGGAAGAGGAAGGAGGAGGAGGG + Intergenic
1160561322 18:79758345-79758367 CTGAAGGAGAAGAAAGAAGCTGG - Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160853089 19:1203509-1203531 CAAAACAGGAAGAAGGCAGATGG - Intronic
1161042821 19:2119071-2119093 CAGAAGAGGAAAAAGGACAACGG + Intronic
1161647591 19:5463400-5463422 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1161821634 19:6533774-6533796 CTGGAGGGGGAGAAGGGAGAAGG - Intronic
1161875936 19:6909566-6909588 AGGAAAAGAAAGAAGGAAGAAGG - Intronic
1161934344 19:7362304-7362326 AGGAGGAAGAAGAAGGAAGAAGG + Intronic
1162105375 19:8366837-8366859 CAAGAGAGGAAGGAGGAAGAGGG - Intronic
1162150001 19:8638413-8638435 CTTAAGTGGCAGAAGCAAGACGG - Intergenic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1162180562 19:8865973-8865995 CTTGAGAGGAAGGAGGAAGAGGG + Intronic
1162205648 19:9054313-9054335 AGGAGGAGAAAGAAGGAAGAGGG - Intergenic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1162836829 19:13325154-13325176 GGAAAGAAGAAGAAGGAAGAAGG - Intronic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163235651 19:16029028-16029050 AGGAGGAGGAAGAAGGAAGAAGG + Intergenic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163387239 19:17007372-17007394 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1163413192 19:17169728-17169750 GTGAAGAGGAAGAGGGAGGCAGG - Intronic
1163511222 19:17736214-17736236 CTCAAGAGAAAGAAGGAAAAAGG - Intergenic
1164324783 19:24181516-24181538 CAGAAGAGGAAGAGGAAAGGAGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164591928 19:29512133-29512155 ATGAAGAGGAAGAAGAGGGAGGG + Intergenic
1164592494 19:29514181-29514203 GGGATGAGGAAGAAGGAGGAGGG + Intergenic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1164718720 19:30415366-30415388 AAGAAGGAGAAGAAGGAAGAAGG - Intronic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1164971708 19:32538561-32538583 ATAAACAGGAAGAGGGAAGAGGG + Intergenic
1165417644 19:35704592-35704614 CTGAAAGGGAAGGAGGAACAGGG + Exonic
1165482528 19:36073173-36073195 AAGCAGAGGAAGAGGGAAGAGGG + Intronic
1165569186 19:36761128-36761150 CTGAAGAGGTGGAAGTAAAAGGG + Intronic
1165603690 19:37080251-37080273 ATTAAGAGGATGGAGGAAGAGGG + Intronic
1165929172 19:39344924-39344946 CTCAAAGGGGAGAAGGAAGAAGG - Intronic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166181051 19:41109144-41109166 CTGAGGAGGTAAAAGAAAGAGGG + Intergenic
1166183523 19:41124696-41124718 CTGGAGAGGAAGCGGGAAGCGGG - Intronic
1166206545 19:41273394-41273416 CTGTACAGGAACGAGGAAGAAGG - Intronic
1166266832 19:41689662-41689684 CTGAGGAGGAGGAAAGGAGAGGG - Intronic
1166429278 19:42710411-42710433 CTGAGAAGAAAGTAGGAAGAAGG - Intronic
1166430889 19:42726833-42726855 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166437704 19:42783125-42783147 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166443905 19:42842168-42842190 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166451347 19:42904836-42904858 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166456652 19:42946923-42946945 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166463587 19:43012832-43012854 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166469739 19:43069409-43069431 TTGAGGAGGAAGAATGAAGCTGG + Intronic
1166480873 19:43172927-43172949 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166486401 19:43217417-43217439 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166490455 19:43256049-43256071 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166493516 19:43280844-43280866 TTGAAAAGGAAAAAGGAAGCTGG + Intergenic
1166864228 19:45826374-45826396 CTGAGGAGGAAGATGGAGAAGGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167145117 19:47676615-47676637 CTGATGATGAAGAGGGAAGGCGG - Intronic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1167608206 19:50492929-50492951 AGTAAGAGGAAGGAGGAAGAAGG + Intergenic
1167620164 19:50556154-50556176 CTGATGAGGAAGCAGGACTAGGG + Intronic
1167627620 19:50603156-50603178 AAGAAGAGGAAGGAGGAAGATGG - Intergenic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1168602429 19:57728437-57728459 TTGGAGTGGAAGAAGGAAGAGGG + Intronic
925112851 2:1351537-1351559 CTGAACAGGTAGAAGAAAGAGGG + Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925256683 2:2495605-2495627 CTGAAGAGTAAGTGGGAACAGGG + Intergenic
925522010 2:4757300-4757322 CGTCAGAGGAAGAGGGAAGAAGG - Intergenic
925656465 2:6155344-6155366 CTGAAGAGGTCTAAGGGAGATGG + Intergenic
925693360 2:6548396-6548418 CTGGAGAGAAAGAAAGAAAAAGG + Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
925752424 2:7101021-7101043 AGGAAGAGGGAGAAGGGAGAAGG - Intergenic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926386152 2:12337746-12337768 CTGAAGAGCAAGCATGAAGATGG + Intergenic
926417660 2:12665651-12665673 CTGAAGTAGAGGAAGGAAGGTGG - Intergenic
926662538 2:15483320-15483342 ATGAAGAGTAAGTGGGAAGATGG - Intronic
926696464 2:15772625-15772647 CTCAAGAGTAAGAAGGGAAATGG + Intergenic
926734083 2:16059251-16059273 GGGAAGAGGAGGAGGGAAGAGGG - Intergenic
927235592 2:20871590-20871612 CTGATGAAGAAGGAGAAAGAAGG + Intergenic
927464015 2:23323690-23323712 CTGCAGAGGAACAGGGAGGAAGG + Intergenic
927951757 2:27175023-27175045 CTGAGGATGCAGAAGGCAGAGGG - Intergenic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928269296 2:29841986-29842008 GTGAAGAGGAGGATGGAGGAAGG - Intronic
928284248 2:29975181-29975203 CTCCAGAGGCAGAAGGATGATGG + Intergenic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928457318 2:31434266-31434288 CAGAAGAGAAAGAATGATGAAGG + Intergenic
928836492 2:35553374-35553396 ATAAAGAGAAAGAAAGAAGAAGG - Intergenic
928939529 2:36713559-36713581 CTGCAGAGGACAAAGGAAGAAGG + Intronic
928950506 2:36809155-36809177 CTGAGTAGGGAGAAGGAACAAGG + Intronic
929424351 2:41828871-41828893 ATGCAGAGGAAGAGGGGAGATGG + Intergenic
929543900 2:42843333-42843355 TTGAACTGCAAGAAGGAAGATGG - Intergenic
929569621 2:43013547-43013569 CTGAAAAGAAAGAACGAAGTAGG - Intergenic
929588134 2:43128679-43128701 GTGGAGAGGAATGAGGAAGAGGG + Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929840909 2:45461927-45461949 CTGAAGAGAAAAAAGGGAGGAGG - Intronic
930110632 2:47675803-47675825 CAGATGGGGAAGAAGGAAGGAGG + Intergenic
930203296 2:48564683-48564705 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
930326107 2:49920603-49920625 TTGAAAAGCAGGAAGGAAGAGGG - Exonic
930806737 2:55497901-55497923 CAGCAGAGGAGGGAGGAAGAGGG + Intergenic
930837595 2:55811153-55811175 CTGAAGAAAAATAAGGAAAATGG - Intergenic
931092246 2:58898806-58898828 CTGAATAGGGACTAGGAAGAGGG - Intergenic
931245819 2:60491969-60491991 CTGGAGAGGAAGATGGATGTAGG + Intronic
931464378 2:62473854-62473876 CAGAAGAGAAAGGAGGAAGTAGG + Intergenic
931565999 2:63616237-63616259 CTGAAGAATAAGAAGGGAGAGGG + Intronic
931593544 2:63913993-63914015 CTGTGGAGTAAGAAGGAAGCAGG + Intronic
931765595 2:65453269-65453291 CTGGGAAGGAAGAAGGTAGAAGG + Intergenic
931853284 2:66275411-66275433 CTGAAGTGTAAGAAGCAAGCTGG - Intergenic
931922615 2:67037567-67037589 TAGAAGAGAAAGAAGGAACAGGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932108080 2:68967325-68967347 GTGAAGACAAAGATGGAAGATGG + Intergenic
932149592 2:69357567-69357589 AAAAAGAGGAAGCAGGAAGATGG - Intronic
932279432 2:70477215-70477237 ATAAAAAGGAAGAAGGAGGAAGG + Intronic
932285552 2:70528910-70528932 CTGAAGTGTAAGAAGGAACAGGG - Intronic
932383871 2:71312682-71312704 CTGAAGAGGAGGAAGAAGAAAGG + Intronic
932430605 2:71671819-71671841 CTGGTCAGGAGGAAGGAAGAAGG + Intronic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933656515 2:84891666-84891688 CTGGCAAGAAAGAAGGAAGAAGG - Intronic
933656712 2:84894531-84894553 TTGAAGCAGAAGAAGGAAGTGGG - Intronic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
933982945 2:87568457-87568479 AGGAAGAGGAGGAAGGAAAAGGG - Intergenic
934331895 2:92075734-92075756 GGGAAGAGGAGAAAGGAAGATGG + Intergenic
934811992 2:97287347-97287369 ATTAAGTGGAAGAAGGAAGAAGG + Intergenic
934825701 2:97420580-97420602 ATTAAGTGGAAGAAGGAAGAAGG - Intergenic
935248155 2:101237253-101237275 AGGAAAAAGAAGAAGGAAGAAGG + Intronic
935383381 2:102476729-102476751 AGGAGGAGGAAAAAGGAAGAAGG + Intronic
935595513 2:104874266-104874288 CTGGAGAGGACAAAGGAAGTTGG + Intergenic
935695414 2:105766909-105766931 CTGCACAGGCAGCAGGAAGACGG - Intronic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
935858480 2:107301276-107301298 CTGAACATGAAAAAGGCAGAGGG - Intergenic
936052479 2:109235306-109235328 ATGAAGAGGAGGTAGGAAGGGGG - Intronic
936310896 2:111382338-111382360 AGGAAGAGGAGGAAGGAAAAGGG + Intergenic
936388367 2:112050873-112050895 AGGAGGAGGAGGAAGGAAGAAGG - Intergenic
936600529 2:113890355-113890377 CTGAGGCGGAGGAAGGAAGATGG + Intronic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
936659221 2:114523608-114523630 CTGTAGAGGGAAAAGGAAGTGGG + Intronic
936731308 2:115384621-115384643 AAGAAGAGGAAGAAGAAAGAAGG + Intronic
936751442 2:115647113-115647135 ATGGACAGAAAGAAGGAAGATGG + Intronic
936765948 2:115848661-115848683 CTGAGGAGGCAGAAGGCAGAAGG - Intergenic
936984704 2:118297877-118297899 ACGAAGAGGTAGAAGGAAGAAGG - Intergenic
937229314 2:120388326-120388348 ATGAGGAGGAAGGAGGCAGATGG + Intergenic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937494932 2:122408452-122408474 CTGGAAAGGAAGGAGCAAGAGGG + Intergenic
937544154 2:122995415-122995437 CTAAAGAGGAAGAAATAAAAAGG + Intergenic
938420168 2:131139273-131139295 CTGAAGAGAGAGAAGACAGACGG - Intronic
938655700 2:133430862-133430884 GTGGAGAGGGAGAAGGAAGGAGG + Intronic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
938982830 2:136542787-136542809 CTCAAGAGGAAGAATGAGAATGG - Intergenic
939089699 2:137765216-137765238 CCTAGGAGAAAGAAGGAAGATGG - Intergenic
939107141 2:137962526-137962548 CTAAAGAGAAAAATGGAAGATGG + Intergenic
939256140 2:139747011-139747033 CGGAAGAGAAAGAGAGAAGAGGG + Intergenic
939272489 2:139958747-139958769 CAAAAGAAGAAGAAGAAAGAAGG + Intergenic
939589885 2:144051882-144051904 CTAAAGTGGAAGATGGAAGTAGG + Intronic
939763477 2:146214716-146214738 CTAAAGATTTAGAAGGAAGATGG + Intergenic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
940164921 2:150760473-150760495 CTGAAAAGGACTAAGGAGGAGGG - Intergenic
940331514 2:152480092-152480114 CTGAAGAGGTAGCAGGTAGCTGG - Intronic
940416042 2:153421204-153421226 GAGAAGAGGATGCAGGAAGAGGG + Intergenic
940509228 2:154591623-154591645 CTCAAGAGAAAGAGGCAAGATGG + Intergenic
940517523 2:154699166-154699188 ATGAAGAAGAGGAAGGCAGAAGG - Exonic
940579113 2:155553590-155553612 CTGAGGATGAAGCAGGAACATGG + Intergenic
940817583 2:158312814-158312836 GTGAAGAGGATGAAAGAGGATGG + Intronic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
940846216 2:158644750-158644772 GTGAAGAGGAAGGAGGAAAATGG + Intronic
941089897 2:161162258-161162280 TTGAAAAGGAAAAATGAAGAGGG - Intronic
941178601 2:162231973-162231995 CTGCAGAGCCAGCAGGAAGATGG - Intronic
941196520 2:162459553-162459575 TTCATGAGGTAGAAGGAAGAAGG - Intronic
941242215 2:163053562-163053584 AGAAAGATGAAGAAGGAAGATGG + Intergenic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
941778220 2:169415682-169415704 CAGAAGAGGAGGAAAGCAGAAGG - Intergenic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
941924675 2:170883371-170883393 CTGAAGAGAAAGGAGAATGAAGG + Intergenic
942305382 2:174601954-174601976 AAGAAGAGGCAGAAGAAAGAGGG + Intronic
942918417 2:181341426-181341448 ATGAATAGGAAGATGGCAGAAGG - Intergenic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943170577 2:184392885-184392907 TTAAAGTTGAAGAAGGAAGAGGG + Intergenic
943180934 2:184540308-184540330 GAGAAGAGAAAGAAGGGAGAGGG + Intergenic
943743651 2:191438275-191438297 CTAAGGAGCAAGAAGGAAGGAGG - Intergenic
943813715 2:192223852-192223874 CTGAAGTGGAAAACCGAAGAGGG - Intergenic
943977530 2:194503357-194503379 CTCAAAAGGAAGAAGCAATAAGG + Intergenic
944046106 2:195413824-195413846 GAGAAGAGGAAAAAGGAAAAAGG + Intergenic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944271124 2:197786000-197786022 CTGAAGAGCAGAGAGGAAGATGG - Exonic
944819326 2:203414003-203414025 CTGAAGAGGATGAGGCAGGAAGG - Intronic
944865731 2:203859639-203859661 CTGAACTGGAAGTATGAAGAGGG + Intergenic
944936820 2:204578217-204578239 CTGAAGAGTAACAAGGAAGCAGG + Intronic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945503898 2:210613967-210613989 CTGAAGGGGAAAAAGAATGAAGG + Intronic
945779152 2:214146335-214146357 CTGAAATGGGAGAAAGAAGAAGG + Intronic
945779318 2:214148457-214148479 ATGTAGTGGAACAAGGAAGAAGG - Intronic
946022868 2:216653637-216653659 CTGGAGATGAGGAAGGCAGATGG - Intronic
946218028 2:218201038-218201060 CAGAAGAGGAAAAAGGCTGAAGG - Intergenic
946224230 2:218254389-218254411 GAGAAGAGAAGGAAGGAAGAAGG + Intergenic
946298433 2:218805906-218805928 CTGAGGAGCATGAAGGAAGAAGG + Intronic
946498276 2:220218456-220218478 CTTGAGTGGAAGATGGAAGAAGG - Intergenic
946532403 2:220585687-220585709 ATGAAGAGGAAGAAGAAAAGGGG - Intergenic
946537951 2:220651746-220651768 CTGAGAGGGAAGAAGGAAGCCGG + Intergenic
946668768 2:222079598-222079620 TAGAGGAGGGAGAAGGAAGAAGG - Intergenic
946970922 2:225090120-225090142 CTGAACAGGAAAACAGAAGAGGG - Intergenic
947042776 2:225942489-225942511 GAGAAGGGGAAGAGGGAAGAGGG + Intergenic
947120468 2:226808924-226808946 CTGAACAGGAATGGGGAAGATGG + Intergenic
947230937 2:227885597-227885619 ATGAAGAGGAAGTGGGAAAAGGG + Intronic
947301998 2:228698033-228698055 CTGAAGACAAAGCAGGAGGAAGG + Intergenic
947343044 2:229159996-229160018 AGGAACAGGATGAAGGAAGAGGG + Intronic
947510995 2:230754325-230754347 AAGAAGAGGAAGGAAGAAGAAGG - Intronic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948290730 2:236822386-236822408 CTTAGGAGGAAGAAGGAAAGAGG + Intergenic
948451990 2:238081423-238081445 CGGAAGAGGAAGAGGCAACAGGG - Intronic
948617010 2:239205662-239205684 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
948661287 2:239508110-239508132 CAGAAGAGGAAGCAGAAAGGGGG - Intergenic
948763145 2:240204849-240204871 CGGGAGAGGAAGAAGCCAGAGGG - Intergenic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
948829580 2:240591789-240591811 AGGATGAGGAAGAAGGCAGAGGG + Intronic
949019623 2:241734128-241734150 CTGAACAGGCAGAAGGGACAGGG + Intergenic
1168759064 20:336373-336395 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1168828849 20:833521-833543 CTGAAGCGGCGGCAGGAAGAAGG + Intergenic
1168829319 20:835916-835938 CTGAAGGGAAAGAAAGAAGCAGG + Intronic
1168889624 20:1286408-1286430 CTGGAGAGGGAGAAGGGAGCTGG + Intronic
1168890187 20:1290355-1290377 CTGGAAGGGAAGAAGGAACAGGG - Intronic
1169004039 20:2192216-2192238 GTGGAGAGGAGGAAGGATGACGG - Intergenic
1169007002 20:2215974-2215996 CTGAAGAGAAAGAAGAAAGGGGG + Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169049848 20:2566693-2566715 TTGAAAAGGTAGAAAGAAGAAGG + Intronic
1169302431 20:4455845-4455867 CTTAAAGGTAAGAAGGAAGATGG - Intergenic
1169751641 20:9000604-9000626 CTGAGGAGGTATAAGGCAGAAGG - Intergenic
1169970371 20:11263509-11263531 CTGCTGAGCAAGGAGGAAGAGGG - Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170417394 20:16159075-16159097 CTGTAGGGGGAGAAGGAAGTGGG - Intergenic
1170589826 20:17763359-17763381 CTGGGGAGGAAGAAGGAATGTGG + Intergenic
1170596035 20:17806641-17806663 AGGAGGAGAAAGAAGGAAGAGGG + Intergenic
1170902239 20:20475749-20475771 ATTAAGAGAAAGAAAGAAGAAGG + Intronic
1170971504 20:21121228-21121250 CTAAAGATGAAGTAGAAAGATGG - Intergenic
1170977839 20:21183044-21183066 ATGAAAAGGAAGAAGGGAGATGG + Intronic
1171326734 20:24300910-24300932 CTGAGCTGGAAGAAGGAGGAGGG + Intergenic
1171958285 20:31475862-31475884 CTGAGGAGGAAGAGGCAGGAGGG - Intronic
1172819791 20:37721512-37721534 CTGAAGAGAAAAAAGGTAGGGGG - Intronic
1172857893 20:38021976-38021998 ATGAATACGAACAAGGAAGAGGG + Intronic
1173025430 20:39303313-39303335 TTTAAGAGAAGGAAGGAAGAAGG - Intergenic
1173189632 20:40866147-40866169 CTGGAGTGGAAGAAGGAAGGAGG - Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173997925 20:47353698-47353720 CTGAGGAGGCAGAAGGAAAAAGG + Intronic
1174150366 20:48482130-48482152 AGGAGGAGGAAGAAGAAAGACGG + Intergenic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1174797693 20:53536157-53536179 CTGCAGAGAAGGACGGAAGAAGG - Intergenic
1174835121 20:53849706-53849728 GAGAGGAGGAAGAAGCAAGAGGG - Intergenic
1174837917 20:53875812-53875834 TTGATGAGGAAGCAGGAACAGGG - Intergenic
1174960499 20:55151679-55151701 AGGAGGAGGAAGAAGGAAGGAGG - Intergenic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175233154 20:57488711-57488733 CAGAACAGGAAGAAGGCCGAAGG + Intergenic
1175310395 20:58007714-58007736 AAGAAGAGGAAGAGGGAATAGGG + Intergenic
1175564017 20:59958558-59958580 CTGAAAAGGGAGGAGCAAGATGG + Exonic
1175588621 20:60168781-60168803 GGGCAGAGGAAGAAGGAAGCTGG + Intergenic
1175825620 20:61934983-61935005 CCGCAAAGGAAGATGGAAGACGG - Intronic
1175878500 20:62242933-62242955 CTGTAGAGGAAGGAGGACTATGG + Intronic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177383901 21:20383213-20383235 TTGAAGGTGAAGAAGGGAGAAGG + Intergenic
1177392349 21:20492553-20492575 CTGAGGAAGAAGAATGAAGTAGG - Intergenic
1177423254 21:20889816-20889838 GAGAAGAGGAAGAAGGAAGTGGG - Intergenic
1177449561 21:21247910-21247932 TTGAAGAGAAAGAAGGAAGAAGG - Intronic
1177521857 21:22237043-22237065 TAGAACAGAAAGAAGGAAGAAGG + Intergenic
1178133293 21:29597656-29597678 GTGAAGAGGAAGCCAGAAGATGG + Intronic
1178191526 21:30287543-30287565 AGGGAGAGGAAGAAGGAAGGAGG + Intergenic
1178225542 21:30713381-30713403 CTGGAGAGGAAGGATAAAGAAGG + Intergenic
1178714914 21:34955450-34955472 ATGAAGGGGAAAAAGGGAGATGG + Intronic
1178760599 21:35398580-35398602 CTAGAGAGGAAGAAGGAATAGGG + Intronic
1179049605 21:37877734-37877756 CTGGAGAGGAAGAAGTGAGAGGG - Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1179642049 21:42754153-42754175 AAGAAGAGGAAAAAGCAAGAAGG - Intronic
1179777128 21:43672217-43672239 CGGAAGTGGGAGAAGGAAGCAGG + Intronic
1180060483 21:45382526-45382548 CTGAGGAGGAAGAAGGAAACAGG + Intergenic
1180220764 21:46356459-46356481 CAGAAGAGGAAAAAAGCAGAAGG - Intronic
1180232023 21:46432414-46432436 TTGAAGAGGAAGAACGAAGTTGG - Intronic
1180462259 22:15575889-15575911 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1180624235 22:17183426-17183448 CAAAAGAGGAAGAAGGAAAGCGG - Intronic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1181951985 22:26560820-26560842 CAGAACAGGAAGAAGGCCGAAGG - Intronic
1182236217 22:28878933-28878955 CTCAAAAAGAAAAAGGAAGAAGG - Intergenic
1182485446 22:30636092-30636114 CTGAAGAGAAAAAAGGAACGAGG + Exonic
1183030530 22:35100673-35100695 CTCAAGAGGAAGCACCAAGAAGG - Intergenic
1183166516 22:36151449-36151471 CTGAAAAGGAACAAAGATGATGG + Intronic
1183680407 22:39325417-39325439 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184142766 22:42588024-42588046 AAAAAGAGGAAGAAGGAACAGGG + Intronic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184218620 22:43084458-43084480 CTGCAAAGAAAGAAGGAAAAAGG - Intronic
1184291801 22:43501374-43501396 AGGGAGAGAAAGAAGGAAGAGGG - Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184977633 22:48074163-48074185 CTGAGGATCAAGAAGGAAGGTGG - Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1185230835 22:49680506-49680528 CTAAAAAAGAAGAAGGAAGTTGG - Intergenic
949196069 3:1309564-1309586 CTGAAGAAGAAGAATAAAGTTGG - Intronic
949417042 3:3826196-3826218 CACAAGAGGAAGAAAAAAGAAGG + Intronic
950096493 3:10333733-10333755 ATGAAGAGGGAGAGGCAAGATGG + Intronic
950111946 3:10424387-10424409 CTCAAGAGTAACAAGGAAAATGG - Intronic
950321777 3:12062071-12062093 CTGAAGAGGAATAAAGTTGAAGG + Intronic
950358200 3:12429419-12429441 CTCAAGAGGAAGGAGGAGGCTGG + Intronic
950898623 3:16476190-16476212 CTCAAGATGGAGAAGGCAGAGGG + Intronic
950907553 3:16552956-16552978 AAGAAGGGAAAGAAGGAAGAAGG + Intergenic
951412534 3:22382113-22382135 CAGAAGAGGAAGAAGGCCGAAGG - Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
951680337 3:25288232-25288254 CTGGAGAGAAAGGAGGAAAATGG + Intronic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
951794474 3:26523492-26523514 GTGAAGAGTAGGAAGGATGAGGG - Intergenic
951870447 3:27355828-27355850 CTGAAGTGGAGGAAGCAAGAGGG - Intronic
951960577 3:28314660-28314682 TGGAATAGGAAGAAGGAACAAGG - Intronic
952206863 3:31188970-31188992 CTGAAAAGAAGAAAGGAAGAGGG + Intergenic
952347365 3:32501328-32501350 AAGAGAAGGAAGAAGGAAGAAGG + Intronic
952525077 3:34201416-34201438 AGGAAGAGGAAGAAGCTAGAGGG + Intergenic
952647616 3:35680760-35680782 GGGAGGAGGAGGAAGGAAGAGGG - Intronic
952766346 3:36957294-36957316 ATGAAGGGGAAGAAGGAAGGGGG - Intergenic
953124979 3:40083425-40083447 GAGAAGGGGAAAAAGGAAGAAGG - Intronic
953188438 3:40660665-40660687 GTGAGGAGGGAGAAAGAAGAAGG + Intergenic
953321377 3:41975219-41975241 CTGAAGACAAGGAAGAAAGAGGG - Intergenic
953406737 3:42663495-42663517 CTGATCAGGAGGAAGGATGAGGG + Intronic
953784158 3:45897755-45897777 CAGACAAGGAAGAAAGAAGAAGG - Intronic
953896584 3:46807845-46807867 CTGATGAGGAAGAAGAAAGAAGG + Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
954581258 3:51704086-51704108 CCCCAGAGGAAGGAGGAAGAGGG - Exonic
954813462 3:53262390-53262412 AGGAGGAGGAAGAGGGAAGAGGG - Intergenic
954855491 3:53640542-53640564 CTGCAGAGGTAGATGGAATATGG + Intronic
955163738 3:56490282-56490304 GTGAAGAGGACGCAGCAAGAAGG + Intergenic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955307444 3:57848500-57848522 AGGAAGAAGAAGAAAGAAGAAGG - Intronic
955307477 3:57848682-57848704 AGGAGGAGGAAGAAAGAAGAAGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955497960 3:59556134-59556156 CAGAACAGGAAGCTGGAAGAAGG - Intergenic
955506935 3:59641828-59641850 CTGCAGAGAAAGTAGGAGGAAGG - Intergenic
955602700 3:60664433-60664455 AGGAAGAGGAAGAAGGGGGAGGG - Intronic
955831012 3:63004105-63004127 CTGGAGAGGAAAAAGAGAGATGG + Intergenic
955871169 3:63440274-63440296 CTGAAGAGTAGGAAAGGAGAGGG + Intronic
956179373 3:66502762-66502784 CAGAAGGGGAAGAAGGAAAAAGG - Intergenic
956390081 3:68762445-68762467 CTGAATAGGTAGAAGGAAATGGG + Intronic
956619205 3:71203872-71203894 GTGCAGAGAAAAAAGGAAGATGG + Intronic
956705730 3:71997442-71997464 ATGAAGAAGAAGAAGAAAGGAGG + Intergenic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957156893 3:76555403-76555425 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
957157074 3:76557843-76557865 CTGAAAAGCAAGAATGAGGAAGG - Intronic
957390340 3:79558259-79558281 CTGAAGCGGAAGAAGAAGGTTGG - Intronic
957477594 3:80746489-80746511 CTGAAGAGGAAAAATTATGATGG + Intergenic
957540124 3:81557464-81557486 AGGAAGAGGAAGAGGGAAGGAGG + Intronic
957766859 3:84636761-84636783 CTGGTGAGGATGCAGGAAGAAGG - Intergenic
957828734 3:85487465-85487487 CTGAAGAAGAAGAAAGGAAAAGG + Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958255887 3:91324414-91324436 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
958560132 3:95737960-95737982 CAGAAGAAGAAGCAGGCAGAGGG - Intergenic
958748057 3:98161758-98161780 CTCAAGAGGATGCAGCAAGAAGG - Intergenic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
959049384 3:101510482-101510504 AAGAAGAGGTAGAAGGAAGGTGG - Intronic
959440239 3:106365348-106365370 AGAAAGAGGAAGAAGGACGAAGG - Intergenic
959526811 3:107386775-107386797 CTGAGGTGGAAGGAGGAAGAAGG - Intergenic
959574463 3:107919405-107919427 TGGAAGAGGAAGGAGGAAGGAGG + Intergenic
959953529 3:112209533-112209555 TTGAAAAGGAAGAAGTAAAATGG + Intronic
960418018 3:117409178-117409200 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
960418334 3:117412670-117412692 GAGAAGAGGAAGAAGGAGAAGGG - Intergenic
960485526 3:118248325-118248347 CTGAAGAGTAAGAATAAACATGG - Intergenic
960603938 3:119485836-119485858 CTGAAAATGAAGAAGGGAGCAGG + Intronic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
960931944 3:122861079-122861101 TGGAAGAGGAAGAAAGAAGAAGG - Intronic
961060232 3:123822489-123822511 CTGCAGATGAAGAAGGATGGAGG - Intronic
961205348 3:125077022-125077044 CTGGAGAGAAGGAAGGATGATGG + Intergenic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961505574 3:127368751-127368773 GAGAAGAGGAAGAAGGCAGTGGG + Intergenic
961553897 3:127684799-127684821 CAGAAGAGGAAGAAGAGTGAAGG + Intergenic
961618853 3:128207202-128207224 AGGAAGAGAGAGAAGGAAGAAGG - Intronic
961870200 3:129982001-129982023 CTGAAGAGTTGGAAGGAAGTAGG - Intergenic
962031477 3:131605382-131605404 CTAGAGAGAGAGAAGGAAGAGGG - Intronic
962276377 3:134017758-134017780 GAGAAGAGGGAGAATGAAGAGGG + Intronic
962390009 3:134963181-134963203 GTACAGAAGAAGAAGGAAGAAGG - Intronic
962870045 3:139480807-139480829 ATCAAGAGGAAGAAGAAAGCAGG - Intergenic
962878548 3:139554484-139554506 GGGAAGAGTAAGTAGGAAGAAGG - Intergenic
963281331 3:143387215-143387237 CTGAAGAGCAAGGAGAAACAAGG + Intronic
963414301 3:144975108-144975130 GGGAAGAGAAAGAAGGAAGAAGG - Intergenic
963601051 3:147379450-147379472 CTAAGGAGGAAGAAAAAAGAAGG + Intergenic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
963796480 3:149635627-149635649 GAAAGGAGGAAGAAGGAAGAAGG + Intronic
964493138 3:157258500-157258522 CAAAAGAGGGAGAAGGAACATGG - Intergenic
964652794 3:159030013-159030035 GTGTAGAGGAAGAAGAAAAAAGG + Intronic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965059844 3:163771804-163771826 TTAAAGAGGAAGAAGGGAGAGGG - Intergenic
965431898 3:168599494-168599516 CTAAAGATGAAGCAGGAAGGAGG + Intergenic
965489625 3:169320422-169320444 CTGAGGAGGAAGGATAAAGAGGG + Intronic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965673811 3:171174026-171174048 CTGCAGAGGAAGGAGGAGCAGGG + Intronic
965961983 3:174440253-174440275 CTGAAGCGAGGGAAGGAAGAAGG - Intronic
966075686 3:175934696-175934718 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
966472484 3:180306824-180306846 ATGCAGAGGAAGAAGAAAGAGGG - Intergenic
966489775 3:180515430-180515452 ATGATGAGAAAGAAGGAATAAGG + Intergenic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
966657919 3:182380445-182380467 GTCAAGAGTAAGAAGGAAGGAGG + Intergenic
966922076 3:184619034-184619056 AGGAAGAGGGAGAAGGAAGGAGG - Intronic
967433733 3:189419882-189419904 CTGAAGATGAAGGGGGAAAAGGG + Intergenic
967446955 3:189578043-189578065 CTGAAGGGAAAGTAGGAGGAAGG - Intergenic
967927559 3:194663356-194663378 CTGAGGCGGAAGAAGGGAAAGGG - Intronic
968208807 3:196829197-196829219 CTGAAGGGGAAACAGGCAGAAGG - Exonic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968781804 4:2588105-2588127 CTGAGGAGTATAAAGGAAGATGG - Intronic
968982367 4:3857166-3857188 CTCAAGTGGAAGAGGGATGAAGG + Intergenic
969085748 4:4655195-4655217 CTGATGAGGAGGAGGCAAGAAGG + Intergenic
969538694 4:7772337-7772359 CTGAAGAGGAACCAGGGACAGGG + Intronic
969565966 4:7978295-7978317 CTGAGGAGGAAGGAGGACTAGGG + Intronic
969926738 4:10592645-10592667 CTGATGGGGGAGTAGGAAGAAGG - Intronic
969955206 4:10882414-10882436 AAGAAGAAGAAAAAGGAAGAGGG - Intergenic
969960841 4:10943547-10943569 CAGGAGGGGTAGAAGGAAGAGGG - Intergenic
969995071 4:11303575-11303597 CGGGAGAAGAACAAGGAAGAAGG - Intergenic
970027996 4:11644376-11644398 ATGAAAAAGAAGAAGAAAGAAGG - Intergenic
970158310 4:13163799-13163821 CTGTAGTGGCAGAAGGGAGAAGG - Intergenic
970360173 4:15301430-15301452 ATGAAGAGGAAGATGAAAAAAGG + Intergenic
970372292 4:15420136-15420158 GTGAGGAGGAAGAAGGATGGGGG - Intronic
970586289 4:17517601-17517623 CTAAGAAGGAAGAAGGAGGAAGG - Intronic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971364158 4:25963576-25963598 CTGAGTAGGGAGTAGGAAGATGG - Intergenic
971512449 4:27443778-27443800 AGGAAGAGAAAGAAGGAAGAAGG - Intergenic
971652263 4:29293432-29293454 TGGAAGAGGAAGGAAGAAGAAGG - Intergenic
971683465 4:29732650-29732672 CTGCAGAGGATGAAGCAATATGG + Intergenic
971849075 4:31960107-31960129 AAGAAGAGAAAGAAGAAAGAAGG - Intergenic
972369950 4:38413746-38413768 CTGGGGAGGAAGGAGGAAGTTGG - Intergenic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
973171825 4:47154839-47154861 CTGTAGAGAAAGAAAGAAAATGG - Intronic
973711433 4:53633721-53633743 CAGAGGAGGAAGATGGATGAGGG - Intronic
973835126 4:54802010-54802032 AGGATGAGAAAGAAGGAAGATGG - Intergenic
973966669 4:56170081-56170103 AGGAAGAGGAGGAAGGAAAAAGG - Intergenic
974084261 4:57242639-57242661 CTTATGAGGAAGAAGTAAGAGGG - Intergenic
974406732 4:61481722-61481744 CTATAGAGGAAAAAGAAAGAAGG + Intronic
974498715 4:62667936-62667958 TAGAAGAGGAAGAATGAATAGGG + Intergenic
974935020 4:68401215-68401237 ATGAGGAGGAAGAGGTAAGAAGG - Intergenic
975156088 4:71074654-71074676 AAGAAGGGGAGGAAGGAAGAAGG + Intergenic
975224054 4:71849045-71849067 CTGAAGAGACAGAAGGGAGTGGG - Intergenic
975336306 4:73180259-73180281 AAGAAGAGAAAGAAGGAACATGG + Intronic
975436220 4:74355143-74355165 ATGAAGAGGGACCAGGAAGAAGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976101877 4:81573105-81573127 CTGAAGAGTTAAAAGGAAGTAGG + Intronic
976119704 4:81766336-81766358 CTGATGAGGAGGGAGGGAGATGG - Intronic
976351563 4:84065903-84065925 CTGAAAAAGAAGAAGGTAGCAGG + Intergenic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
976757435 4:88513447-88513469 AAGAACAGGAAGAAGGAAAAGGG - Intergenic
976885049 4:89971587-89971609 AGGAAGAGGAGGAGGGAAGAGGG - Intergenic
976934845 4:90617274-90617296 CTGAAGAGGAAAGAGCAAAATGG + Intronic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
977539701 4:98301847-98301869 ATGAAAAGAAAGAAGCAAGAGGG + Intronic
977770433 4:100851340-100851362 CTAAAGAGGAATATGGAAAAAGG + Intronic
978151671 4:105443332-105443354 GTGAAGAAGCAGAAGGCAGAAGG + Intronic
978235815 4:106458543-106458565 AGGAAGAAGAAGGAGGAAGAAGG + Intergenic
978268538 4:106858987-106859009 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
978359165 4:107909915-107909937 TGGAAGTGTAAGAAGGAAGATGG - Intronic
978624981 4:110675043-110675065 GTCAGGAGGAAGGAGGAAGAAGG + Intergenic
978978562 4:114912553-114912575 ATGAAAAGCAAGGAGGAAGACGG + Intronic
978987394 4:115030063-115030085 ATGAAGAGGAACAATGAAAAAGG + Intronic
979263812 4:118678474-118678496 AGGAGGAGGAAGAAGAAAGAAGG + Intergenic
979283739 4:118897424-118897446 TTAAACAGGATGAAGGAAGAGGG - Intronic
979490433 4:121320522-121320544 CTGAAGGGGAGGCAAGAAGATGG - Intergenic
979551172 4:121992537-121992559 CACAAGAGGGAGAAGGAAGGTGG - Intergenic
979608087 4:122660333-122660355 CTGAATTGGAATAAGGAATAAGG - Intergenic
979712994 4:123802847-123802869 GGGAAGAAGAGGAAGGAAGACGG - Intergenic
979757093 4:124354483-124354505 TTGAAGAAGAAGAAGAAAGTTGG - Intergenic
979975214 4:127187908-127187930 CTGAAGAGGATGTAGCAAAAAGG + Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980297170 4:130936028-130936050 TTGGAAAGGAAGAAGAAAGACGG - Intergenic
980394242 4:132188928-132188950 CTAAAAAGGAAGAAGGAGCAGGG - Intergenic
980537976 4:134153972-134153994 CCAAAGAGGAAAAAGGAAGGTGG + Intergenic
980810891 4:137877846-137877868 AGGATGAAGAAGAAGGAAGATGG + Intergenic
980893536 4:138839413-138839435 CTGCAGGGGAAGGAGGCAGAGGG + Intergenic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981001426 4:139832567-139832589 CTGCAGGGGAAGAACGAAGTTGG - Intronic
981023054 4:140048926-140048948 GTGAAGAGGAAGAATGAACAGGG + Intronic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
982406708 4:155028714-155028736 AAGAAGAGGAAAAAGGAAGATGG - Intergenic
982446135 4:155492522-155492544 ATGAAGACATAGAAGGAAGATGG + Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
983379837 4:166978700-166978722 GAGAAGGAGAAGAAGGAAGACGG + Intronic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
983552567 4:169032466-169032488 AGGAAAAGGAAGAAGGAAGAGGG - Intergenic
984036298 4:174672377-174672399 TTGGAGAGGAAGAAAGAAAAAGG - Intronic
984583290 4:181534775-181534797 CTGGAGAGGAAGATGCAACAGGG - Intergenic
984594945 4:181656201-181656223 CTGCAGAGGAAGATGGGAAATGG + Intergenic
984931638 4:184852893-184852915 ATGCAGAGGAAGAGGTAAGATGG - Intergenic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
985128418 4:186718183-186718205 TTTAAGAGGAGGAGGGAAGATGG - Intronic
985210099 4:187583462-187583484 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
985232304 4:187833379-187833401 CTGGAAAGGAAGAAGTAAAATGG - Intergenic
985347648 4:189023526-189023548 TTGAAGAGGAAGAATAAAAACGG + Intergenic
985898094 5:2762337-2762359 AAAAAGAGGAAGAAGGAAAAAGG + Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986178584 5:5372867-5372889 CTGAGGAGGCAGAAGGCAGAAGG + Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986408689 5:7453526-7453548 CTTAGGAGGCAGAAGGCAGAAGG + Intronic
986634907 5:9811624-9811646 CAGAAGAAGAAGAAGAAAAAAGG - Intergenic
986643376 5:9893156-9893178 TTGTAGGGGAAGAAGGAAGAAGG - Intergenic
986997711 5:13626143-13626165 CACAAGAAGAAGAAGAAAGAGGG + Intergenic
987190887 5:15477204-15477226 GAGAAGAGGGAGAAGGAAAATGG - Intergenic
987418575 5:17691490-17691512 CTGGAAAGGAAGCAGGAAGGAGG - Intergenic
987524559 5:19030774-19030796 GTGAGGAGGAAGAAGGGAGAAGG - Intergenic
987837397 5:23179064-23179086 CTGATGAGGAAGAATGAATCTGG + Intergenic
988269847 5:28999731-28999753 CTGAAGAGTTAAAATGAAGATGG + Intergenic
988490391 5:31700712-31700734 CTGAGGAGGAAAAGGGAAGAAGG + Intronic
988608758 5:32705433-32705455 CTGTACAGGAAGCAGGATGATGG + Intronic
988632089 5:32942416-32942438 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
988680668 5:33481106-33481128 ATGAAGAGGAAGAGGAATGAAGG - Intergenic
988680725 5:33481266-33481288 ATGAAGAGGAAGGAGAATGAAGG - Intergenic
988782004 5:34530753-34530775 CTGAGAAGTAAGAAAGAAGATGG - Intergenic
989138834 5:38182141-38182163 CCCAAGAGAAAGAAGGAGGATGG - Intergenic
989140034 5:38192830-38192852 CTCAAGAGGAAGGAAGAAAAAGG - Intergenic
989146376 5:38254671-38254693 CTAGAGAGGAAGCATGAAGAGGG + Intergenic
989352988 5:40508997-40509019 ATGAAGAAGAAGAAGAAAAAAGG - Intergenic
989354515 5:40528420-40528442 TAGTAGAGGAGGAAGGAAGATGG - Intergenic
989494080 5:42090856-42090878 CTACTGAGGAAGAATGAAGATGG - Intergenic
989756213 5:44958748-44958770 AGGAGAAGGAAGAAGGAAGAAGG - Intergenic
989822790 5:45815672-45815694 CTAAAGAGGAAGAACAAAGTTGG + Intergenic
989973357 5:50551835-50551857 GTGAGGTGGAAGAAGGAAGGAGG + Intergenic
990153675 5:52849464-52849486 ATGAAAATGAAGAAGGAAAATGG + Exonic
990495128 5:56339514-56339536 TAGAAGTGGAAGAAGGAAGGAGG - Intergenic
990895438 5:60695325-60695347 GTGAAGCGGAAGCAGGCAGAAGG + Intronic
991350179 5:65713254-65713276 GTGAGGGGGAGGAAGGAAGAAGG - Intronic
991611944 5:68458546-68458568 CTAAAGAGGCAGCAGGAAGAAGG + Intergenic
991929181 5:71735250-71735272 TGGAAGAGGAAGTTGGAAGAGGG - Intergenic
992948880 5:81837453-81837475 GGGAAGATGAAGAAGGAACAGGG - Intergenic
993346562 5:86790917-86790939 CTGAAATGGATGAATGAAGAAGG - Intergenic
993503493 5:88686446-88686468 CTGGAGTGGGAGAAGGGAGATGG - Intergenic
993903454 5:93599276-93599298 GTGAAAAGGAGGAAGGAAGAAGG + Intergenic
993947158 5:94129570-94129592 CTGAACAGGAGGAAAGAACATGG + Intergenic
994703728 5:103172512-103172534 TAGAAGAGGAGAAAGGAAGAAGG - Intronic
995366535 5:111367801-111367823 GTCCATAGGAAGAAGGAAGAAGG - Intronic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
995736198 5:115302643-115302665 CTAGACAGGAAGAAGGAAAAGGG + Intergenic
995907442 5:117142504-117142526 AGGAAGAGGAAGAAGAAGGAGGG - Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996476118 5:123923092-123923114 TTGAAAAGGAAGTAGGAAGCTGG - Intergenic
996732073 5:126726095-126726117 AAGAGGAGGAAGAAGAAAGAAGG + Intergenic
997211072 5:132077091-132077113 CTGAAGTAGAGGAAGCAAGAGGG - Intergenic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997804623 5:136904994-136905016 GAAAGGAGGAAGAAGGAAGAAGG - Intergenic
998005624 5:138655054-138655076 GAGAAGAGAAAGAAGAAAGAGGG + Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998225760 5:140325053-140325075 CTGAAGAGCAAGAGGGCAGCTGG + Intergenic
998344839 5:141452731-141452753 AGGAAGAGAGAGAAGGAAGAAGG + Intronic
998565572 5:143213319-143213341 GGGAGGAGGAAGAAGGGAGAGGG - Intronic
998604037 5:143615486-143615508 AGGAGGAGGAAGAAAGAAGAAGG - Intergenic
999084817 5:148878267-148878289 AAGAAGAGGAGGGAGGAAGAGGG + Intergenic
999189405 5:149735376-149735398 TTCCAGAGGAAGAAGGAAGAGGG - Intronic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999450008 5:151670890-151670912 CTGAAGATGGAGAAGCCAGATGG + Intronic
999505141 5:152186676-152186698 CTGCAGAGGAAGAAGGAAGTTGG - Intergenic
999570145 5:152910658-152910680 TGGAGGAGGAAGAAAGAAGAGGG - Intergenic
999585537 5:153085747-153085769 GAGAGAAGGAAGAAGGAAGAAGG + Intergenic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000302114 5:159965658-159965680 TGGCAGAGGAAGAAGGAGGAAGG + Intronic
1000330518 5:160201653-160201675 GGAAAGAGGAAGAAAGAAGAAGG - Intronic
1000444866 5:161307119-161307141 GTGGTGAGGAAGGAGGAAGAAGG - Intronic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1000795429 5:165658653-165658675 TTGAAGAGAAAAAAGGAAAAGGG - Intergenic
1000865535 5:166509658-166509680 CTGAAGAAGGACAAGAAAGAGGG + Intergenic
1001129335 5:169050764-169050786 CTGAAGAGGAAGAATACACATGG + Intronic
1001316711 5:170647325-170647347 CTGAAGAAGAAGAAAAAAGTTGG + Intronic
1001609016 5:172984727-172984749 CAAAAGAGGAACCAGGAAGAGGG - Intronic
1001675456 5:173509381-173509403 CTGAAGAGAAAGAACAAAGCTGG - Intergenic
1001681719 5:173562828-173562850 CTGGAGAGGAATAAACAAGAGGG + Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001840972 5:174876438-174876460 CAGAAGAGGAAGCAGGCAGGTGG + Intergenic
1001871861 5:175163124-175163146 ATGAAGAGGAAGAAAGGAAATGG + Intergenic
1002171945 5:177379824-177379846 AGAAAGAGAAAGAAGGAAGAAGG - Intronic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002406007 5:179032064-179032086 AAGAAGAGGAGGAAGGAAGCAGG - Intronic
1002482212 5:179510095-179510117 AGGAAGAGGAAGAAAGAAGAAGG - Intergenic
1002583033 5:180222011-180222033 CTGAAGAGGAGGAAGTGACATGG + Intergenic
1002882564 6:1265854-1265876 ATGAAGGGGAAGAAGGAGCAAGG + Intergenic
1002969130 6:1996119-1996141 AAGAAGAGGAAGGAGGAAGGAGG - Intronic
1003006453 6:2387065-2387087 GAGAAGAGGAAGCAGGAACATGG + Intergenic
1003389822 6:5703967-5703989 CGGCAGAGGAAGGAGGAAGAGGG - Intronic
1003561274 6:7182724-7182746 TTGAACAGAAAGAAGGAAGGTGG + Intronic
1003577547 6:7312354-7312376 AAGAAGAGGAAGAAGGCAGAAGG + Intronic
1003612270 6:7624521-7624543 CAGAAGAGGAAAAAGGGAGAAGG + Intergenic
1003693675 6:8380147-8380169 AAGAACAGCAAGAAGGAAGAGGG + Intergenic
1003940122 6:11016151-11016173 GAGAAGGGGAAGAAGGAAGAAGG - Intronic
1003953713 6:11142882-11142904 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1004055683 6:12136053-12136075 ATGAATAGGAAGGAGGAAGGAGG - Intronic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004233243 6:13851487-13851509 CTGAGGAGGCAGAAGGACAAAGG - Intergenic
1004266451 6:14152078-14152100 AGGAAGAGGAAGAAGGAAGGAGG - Intergenic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1004755630 6:18607737-18607759 CAAGAGAGGAAGAAGGGAGAAGG + Intergenic
1004989325 6:21119143-21119165 CTCAACAGGAAGAAAGAGGAAGG - Intronic
1005167764 6:22944738-22944760 CATCAGAGGAAGATGGAAGAGGG + Intergenic
1005438385 6:25838686-25838708 CTGAATAGCAAGAAGGAACAAGG - Intronic
1005493013 6:26364073-26364095 GGCAAGAGGAAGAAGGAAGAAGG + Intergenic
1005495401 6:26383568-26383590 GGGAAGAGGAAGGAGGAAAACGG + Intronic
1005497453 6:26400574-26400596 CTGGGGAGGAAAAAGGGAGAGGG + Intergenic
1005758180 6:28944121-28944143 CTGAAGTGGATGAAGGGCGAGGG - Intronic
1006409154 6:33862284-33862306 GTGAAGAGGATGCAGGAAGGTGG + Intergenic
1006510634 6:34519318-34519340 TTGAGGAGGAAGGAGGAGGATGG - Intronic
1006730406 6:36231752-36231774 TTGAAGAGAAAGAAGGAAGGAGG - Exonic
1006843440 6:37046794-37046816 GTGAAGAGAAAGAGAGAAGACGG + Intergenic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007371608 6:41429872-41429894 TTGAAGAGGGAGAGGGGAGAGGG - Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007616520 6:43182705-43182727 GTGAAGAGGAGGGAGAAAGATGG - Intronic
1007622389 6:43222993-43223015 ATGAAGAGGAAGAGGAGAGAGGG - Intronic
1007667915 6:43526840-43526862 CAGGTGAGGAAGGAGGAAGATGG + Intronic
1007724132 6:43904275-43904297 CTGTAGAAGAACAAGAAAGAAGG - Intergenic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1007909681 6:45501048-45501070 CTGGAGAGGTTGAAGGTAGATGG + Intronic
1007935798 6:45730767-45730789 GTGAAGAGGAAGAAGAAAGGGGG - Intergenic
1007949741 6:45860654-45860676 CTAATGAGGAAGAATGAGGATGG + Intergenic
1008125718 6:47666066-47666088 AGGAAGAGGAGGAAGAAAGAAGG - Intronic
1008510086 6:52267856-52267878 CAGAAGAGGAAGAGGTAAGGTGG - Exonic
1008581206 6:52908958-52908980 AGGAGGAGGAAGAAGAAAGAGGG + Intronic
1008696072 6:54039349-54039371 CTGAAGAGGAATAAGTATGTTGG + Intronic
1008869203 6:56252065-56252087 AAGAAGAGAAAGAAGAAAGAAGG - Intronic
1008874965 6:56315650-56315672 AGGGAGAGGAGGAAGGAAGAGGG - Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009001562 6:57723092-57723114 CTGGGGAGGAAGAAGATAGATGG + Intergenic
1009055500 6:58329791-58329813 CTGAAGGGAAAAAAGGAAAAAGG + Intergenic
1009235666 6:61120784-61120806 CTGAAGGGAAAAAAGGAAAAAGG - Intergenic
1009435852 6:63617807-63617829 ATGAAGAGCAAAAATGAAGATGG - Intergenic
1009450686 6:63796873-63796895 CAGGAAAGGAAGAAGGGAGAAGG - Intronic
1009881320 6:69569922-69569944 AGGAAGAGGAAGAGAGAAGAAGG - Intergenic
1009994833 6:70886558-70886580 CTGAAGGGGAAGTGGGGAGACGG - Intronic
1010311381 6:74389870-74389892 AAGAAGAGGAAGGAGGAAGAAGG - Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010719893 6:79271005-79271027 AAGAAGAGGAAGATGGAAGGAGG + Intergenic
1011219283 6:85036861-85036883 CAGAAGAGGAAGCAGGGAAATGG + Intergenic
1011242319 6:85286038-85286060 CGACAGAGGAAGAAGGAAGCGGG + Intergenic
1011389648 6:86837927-86837949 CTTTAGAGGAAAATGGAAGAGGG + Intergenic
1011568061 6:88701143-88701165 AAGAAGAAGAAGAAGGTAGATGG + Intronic
1011625759 6:89282291-89282313 CTGTAGGGGAAGAAGACAGATGG - Intronic
1011871665 6:91901951-91901973 AAGAGGAGGAAGAAGGAAAATGG + Intergenic
1012262072 6:97099335-97099357 CTGAAGAGGAAAAAGAAACTGGG - Intronic
1012348476 6:98221649-98221671 CTCCAGAAGAAGAAGAAAGATGG + Intergenic
1012556915 6:100524791-100524813 TTGAAGAGGAGGAAGGATAAAGG - Intronic
1012633442 6:101503349-101503371 ATGAATAGAAAGGAGGAAGAAGG + Intronic
1012813481 6:103990700-103990722 CTGAAGAGCAAAAAGGGAGAGGG - Intergenic
1012979725 6:105816733-105816755 CTTTGAAGGAAGAAGGAAGAGGG - Intergenic
1012995274 6:105966685-105966707 CTGATGATGAAGTGGGAAGATGG - Intergenic
1013191582 6:107808270-107808292 CTGATGGGCAAGGAGGAAGACGG - Intronic
1013470508 6:110460132-110460154 CTGCAAAGGAAGAAGGGCGATGG - Intronic
1013761875 6:113528277-113528299 CTGAAGAGGTGGAAGAATGAAGG + Intergenic
1013976581 6:116085838-116085860 ATGAAAAGGAAGAAAGAAAATGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014886296 6:126785407-126785429 ATGAAGAGTAGGAAGGAAGAAGG - Intergenic
1015024016 6:128511303-128511325 CTAATGGGGAAGAAAGAAGATGG - Intronic
1015026155 6:128535243-128535265 CTGAAGTGGAGGAAGGCAGTTGG - Intergenic
1015066672 6:129038383-129038405 CTCATGATCAAGAAGGAAGATGG - Intronic
1015203779 6:130612427-130612449 CTGAATAGGGACAAGGAAGTTGG + Intergenic
1015242978 6:131046701-131046723 TTAAGGGGGAAGAAGGAAGATGG + Intronic
1015370853 6:132450822-132450844 CTCAAAAGAAAGAAGAAAGAAGG + Exonic
1015648667 6:135427509-135427531 TTGAAGAGGTAGAAAGTAGAAGG - Intronic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016098558 6:140068463-140068485 CCTAAGAGGAAGAAAGAATAAGG - Intergenic
1016154427 6:140786229-140786251 CTGAAGAGGAAGAATCAAGCTGG + Intergenic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016918528 6:149267276-149267298 AGGAAGAGGAAGAAGGAATCTGG - Intronic
1016987062 6:149903595-149903617 AGGAAGAGGCAGACGGAAGAGGG + Intergenic
1017462959 6:154668372-154668394 GAAAGGAGGAAGAAGGAAGAAGG + Intergenic
1017546182 6:155452803-155452825 CTGATGAGGAAGAAAGGAGGAGG - Intronic
1018038057 6:159898587-159898609 AGGAAGAGGAAGGAGGAACAGGG - Intergenic
1018038656 6:159903088-159903110 CTGAAGGGGAAGGAGGAGGTGGG - Intergenic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018297502 6:162364743-162364765 GTGAAGGGGAATCAGGAAGAGGG + Intronic
1018424046 6:163664057-163664079 CTGCTCAGGTAGAAGGAAGAGGG - Intergenic
1018516305 6:164583427-164583449 TAGAAGAGAAAGAATGAAGATGG - Intergenic
1018729634 6:166638973-166638995 ATGAAGAGGGAGGAAGAAGAGGG + Intronic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1018915903 6:168132194-168132216 CTGAGAAGGAGGCAGGAAGAAGG - Intergenic
1019131211 6:169877433-169877455 CTAAAAAGGAAGACGGAAGAAGG - Intergenic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019484077 7:1280492-1280514 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1019484109 7:1280652-1280674 GGAAGGAGGAAGAAGGAAGAAGG + Intergenic
1019840139 7:3433527-3433549 AGGAAGAGGAAGAAGAAATAGGG - Intronic
1019937738 7:4267331-4267353 GAGAAAAGGAAGAAGGAATAGGG - Exonic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1020392756 7:7676082-7676104 CTTCTGCGGAAGAAGGAAGAGGG - Intronic
1020429899 7:8108108-8108130 CTGAAGGGAAAGAAAGAAAAAGG - Intergenic
1020466956 7:8491079-8491101 CTGATGAGGAAGAAGGCAACTGG - Intronic
1020467314 7:8495663-8495685 ATGCAGAGGAAGAAAGAAGTGGG + Intronic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020681893 7:11246823-11246845 CTGACCAGGAAGAGGAAAGAAGG + Intergenic
1020898884 7:13977356-13977378 CCAAAGAGAAAGAAGAAAGAAGG + Intronic
1021295909 7:18905799-18905821 TTGATGAGGGAGAAGGAAGAAGG - Intronic
1021301642 7:18980792-18980814 AGGAGAAGGAAGAAGGAAGAAGG - Intronic
1021450988 7:20784137-20784159 CACAGAAGGAAGAAGGAAGAGGG + Intronic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1021712673 7:23431617-23431639 CTGAACAGGAGGAAGGAAGGGGG + Intronic
1022015417 7:26345012-26345034 GTGAAGACGAAGACGGAGGAGGG - Intronic
1022096161 7:27142878-27142900 AAGAAGAGGAGGAAGGAGGAAGG + Intronic
1022274648 7:28843283-28843305 CTGTAGATGATGGAGGAAGATGG - Intergenic
1022349251 7:29551555-29551577 GAGAAGAGGATGAAGGAGGAGGG + Intergenic
1022491480 7:30823457-30823479 ATGAAGGGAAAGAAGGAAGAAGG - Intronic
1022670299 7:32449357-32449379 AAGAAGAGGAAGAAGGAGAAGGG + Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023214548 7:37847802-37847824 AGGAAGAAGAAGAAGAAAGAAGG + Intronic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1023643719 7:42287629-42287651 CAGAAGAGGGAGAATAAAGATGG - Intergenic
1023693448 7:42818728-42818750 GAGAAGGAGAAGAAGGAAGAAGG + Intergenic
1023708484 7:42967067-42967089 CAAAGGAGGAGGAAGGAAGAGGG - Intergenic
1023792226 7:43762114-43762136 TTGAGGAGGAACAAGGAGGAAGG + Intronic
1023910663 7:44553352-44553374 GCGAGGAGGAAGAAGGAGGAGGG + Intergenic
1024032257 7:45471409-45471431 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1024787629 7:52926409-52926431 GAGAAGAGGAAGAAGAAAGGGGG + Intergenic
1025026591 7:55521630-55521652 AGGAAGAGAAAGAAGGAACAAGG + Intronic
1025275532 7:57579005-57579027 GTGACAAGGAGGAAGGAAGAGGG - Intergenic
1025758285 7:64366833-64366855 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1026129922 7:67611932-67611954 AGGAAGAGGCAGAAGGGAGATGG - Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026228756 7:68465398-68465420 CTTCAGAGTGAGAAGGAAGAGGG - Intergenic
1026304671 7:69130199-69130221 CTTAAAGGGAAGAAGAAAGAGGG + Intergenic
1026345990 7:69474667-69474689 GTGAAGAGAAAAGAGGAAGAGGG + Intergenic
1026488753 7:70845244-70845266 CTGAAAAGCAAGAAGGAAAATGG + Intergenic
1026684925 7:72501464-72501486 AGGAGGAGGAAGAAGGAAGGAGG + Intergenic
1026789764 7:73324075-73324097 AGGGAGAGGAAGAGGGAAGAGGG + Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027184891 7:75965155-75965177 CTGACTTGGAAGCAGGAAGATGG + Intronic
1027746274 7:82078873-82078895 AGAAAGAGGAAGAAGAAAGAGGG + Intronic
1027970825 7:85078846-85078868 CTAGAGAGGAAGAAGGAGAAAGG + Intronic
1028199527 7:87944893-87944915 AGGAAGAAGAAGAAGGAAGGAGG - Intronic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028387224 7:90269756-90269778 GTGAAGAAAAAGAAAGAAGATGG + Intronic
1028491870 7:91421741-91421763 CAAAACAGTAAGAAGGAAGAGGG - Intergenic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1028753525 7:94409478-94409500 GGGAAGAAGAAGAATGAAGATGG + Intronic
1028921376 7:96314108-96314130 AGGAGGAGGAAGAAGGAGGAAGG + Intronic
1029087027 7:98019788-98019810 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1029967462 7:104754991-104755013 ATGAGGAGGAAGAAGGAAGTGGG + Intronic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030095042 7:105891251-105891273 CTGAATAGGAGGATGGGAGAGGG - Intronic
1030379219 7:108793156-108793178 CTGAAGAGGAAAAAAAAAGTCGG + Intergenic
1030462405 7:109855904-109855926 AAGAAGAGGAAGAAGGAAGAAGG + Intergenic
1030490788 7:110231405-110231427 CTCCAGAGGATGCAGGAAGAAGG + Intergenic
1030680470 7:112428532-112428554 CTGAAGAGGAAATAGGATGAAGG + Intronic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1030891143 7:115001045-115001067 CTGAAGGGAAAAATGGAAGATGG + Intronic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1031214827 7:118877175-118877197 GGGAAGGGGAAGAAGGAAAAGGG + Intergenic
1031303553 7:120095268-120095290 AGAAAGAGAAAGAAGGAAGATGG + Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031863850 7:127015129-127015151 AGGAGAAGGAAGAAGGAAGAAGG + Intronic
1031944125 7:127820717-127820739 TTGAGGAGGAGGAAGGAAAATGG - Intronic
1032209498 7:129900535-129900557 ATGGAGAGGAAGAAGAAACATGG - Intronic
1032341906 7:131081788-131081810 CTGACCAGGAAGAAGGGAAAGGG + Intergenic
1032363881 7:131281471-131281493 TTGAAGAGGAAGAACAAAGTTGG - Intronic
1032498645 7:132382210-132382232 GAGAAGAGGAAGCAGGAAGAGGG + Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032615397 7:133463787-133463809 GCAAAGGGGAAGAAGGAAGAAGG + Intronic
1032669383 7:134069354-134069376 GAGAAGAGGGAGGAGGAAGAAGG - Intergenic
1032669396 7:134069408-134069430 GAGAAGAGGAGGAAGGAGGAAGG - Intergenic
1032697261 7:134348125-134348147 CTGGAGAGGAATAAGGAAAATGG - Intergenic
1032871459 7:135990447-135990469 CAAAAGAGGAAGAAGGAATAGGG + Intergenic
1032884739 7:136125140-136125162 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1032932820 7:136694118-136694140 CTGAAGAGGAAGATGAATGCGGG - Intergenic
1033449351 7:141448927-141448949 GTGAACAGGAGGAGGGAAGAGGG + Intronic
1033536812 7:142320363-142320385 CCGAAGAGGGAGAATGAAGATGG + Intergenic
1033890425 7:146006381-146006403 AGGAGGAGGGAGAAGGAAGAGGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034035901 7:147821703-147821725 CTGAAGAGAAACAGGAAAGAAGG + Intronic
1034212293 7:149374428-149374450 CGGAAGAGGAGGAAGAGAGAGGG + Intergenic
1034270007 7:149798814-149798836 CTGGAGAGGAAGGAGGGTGAGGG + Intergenic
1034427074 7:151019576-151019598 TAGAAGAGGATGAAGGAAGTAGG - Intronic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035309597 7:157956991-157957013 CTAGAGAGTAAGAAGGAAAAGGG + Intronic
1035489711 7:159263163-159263185 AGAAAGAGGAAGAGGGAAGAGGG + Intergenic
1036166469 8:6438840-6438862 TTGAAAGGGAAGAAGGAAAACGG + Intronic
1036634250 8:10538235-10538257 CTGAAGATGGGGAAGGAAGGGGG - Intronic
1037091694 8:14927533-14927555 AGGAAGAGGAAGAAAGAAGAGGG + Intronic
1037317454 8:17612342-17612364 AGGAGAAGGAAGAAGGAAGAGGG - Intronic
1037542453 8:19885559-19885581 GGGAAGAGGGAGAAGGGAGAAGG - Intergenic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1037896588 8:22660535-22660557 AGCAAGAGGTAGAAGGAAGATGG + Intronic
1037979852 8:23245082-23245104 CTGAAGAGGAAGAAATAAAATGG - Intronic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1038930581 8:32189227-32189249 CTGAGGGGGAAGACGGAAGGGGG - Intronic
1039053552 8:33515621-33515643 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1039144141 8:34426597-34426619 CTGAAACTGAAGAAGGCAGATGG - Intergenic
1039226504 8:35393979-35394001 AGAAAGAGGAAGAAGGATGAAGG - Intronic
1039262856 8:35791235-35791257 AGGAAGAGGAAGAAAGAATAAGG - Intronic
1039439388 8:37584256-37584278 CTGAAGAGGAAGGAGGGGAAGGG + Intergenic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1039806188 8:41001730-41001752 AAGAGGAGGAGGAAGGAAGAAGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039906162 8:41787807-41787829 CTCAAAAGGAAGAAGAAAGAAGG + Intronic
1039986038 8:42448727-42448749 CGGAGGAGGAAGAAGAGAGAAGG + Intronic
1040398026 8:47018311-47018333 TGGAAGAGGAAGACAGAAGATGG + Intergenic
1040733618 8:50479699-50479721 CTGAAGAGGAGGAAGGCACAGGG - Intronic
1041111749 8:54489418-54489440 CTGAACAGGAAGAAGGAAGGAGG + Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041512401 8:58666434-58666456 CTGAGGAGAAATAAGGAGGAAGG + Intergenic
1041528041 8:58830653-58830675 CAGAAAAGAAGGAAGGAAGAAGG - Intronic
1042025259 8:64416137-64416159 CTGAAGAGGGGGAAGAAATAGGG - Intergenic
1042055399 8:64759050-64759072 GAGAAAAGGAAGGAGGAAGAAGG + Intronic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042289844 8:67158499-67158521 CAGAAGAAAAAGAAGAAAGACGG + Exonic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042482428 8:69319314-69319336 TAGAAGAGGGAGAAGGAAAAGGG - Intergenic
1042860454 8:73308060-73308082 AGGAAGAGAAAGAAGGAAGCTGG - Intronic
1043005922 8:74818528-74818550 CTGAAGAAGAATAAGCATGAAGG - Intronic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043981439 8:86645325-86645347 CAAAAGAGGAAGTAGGAAGTAGG - Intronic
1044312151 8:90706286-90706308 CTGAATAGGCAAAAGGTAGAAGG - Intronic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044489317 8:92793311-92793333 CTGAAGAGTCAGAGGGAAGTAGG + Intergenic
1044817183 8:96125204-96125226 CTGAAAAGGGAGGTGGAAGAGGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044985521 8:97753283-97753305 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
1045031203 8:98138124-98138146 CTGAAAAGGAGGAAGGATGGAGG - Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045332313 8:101166032-101166054 CTATAGAAAAAGAAGGAAGAGGG + Intergenic
1045827449 8:106415801-106415823 GTTAAAAGGAAAAAGGAAGAAGG - Intronic
1046101726 8:109622008-109622030 ATGAAGAGGAAGAAAGGAGGAGG - Intronic
1046373411 8:113342969-113342991 AGGAAGAGGAAGAAGAAAAATGG + Intronic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046748675 8:117903641-117903663 CTGAAGAAAAAGGAGGAAAATGG - Intronic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047021502 8:120779617-120779639 CTGACTAGGACAAAGGAAGAGGG + Intronic
1047158367 8:122348072-122348094 CAGAAGAGAAAGAAGAAAGGAGG + Intergenic
1047309887 8:123683107-123683129 CTGGAGAGAAAGGAGGGAGAGGG + Intronic
1047640903 8:126820878-126820900 TTGGAGAGGAAGAAGGGAGATGG + Intergenic
1048056360 8:130869962-130869984 AGGAGGAGGAAGAAGGAAGAAGG - Intronic
1048225022 8:132576868-132576890 CAGAAGTGGAAGAAGGGAGAGGG + Intronic
1048235250 8:132683495-132683517 CAGAAGACCAAAAAGGAAGAGGG - Intergenic
1048235597 8:132686791-132686813 TTGAAGGGGAAGAATGGAGAAGG + Intronic
1048292817 8:133193358-133193380 CTGCAGTGGAAGGAGGAAGATGG + Intronic
1048448327 8:134509750-134509772 CTTAAGAGGAAGAAGCAAAGAGG + Intronic
1048599648 8:135906230-135906252 CAGGCGAGGAAAAAGGAAGAAGG - Intergenic
1048828816 8:138456394-138456416 CTGAAGAGGGTGAAGGGAGTGGG + Intronic
1048928570 8:139292403-139292425 CAGAAATGGATGAAGGAAGAAGG - Intergenic
1048985795 8:139734038-139734060 CTGAAGAGGATGGGGGCAGAGGG + Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049331698 8:142058008-142058030 AGGAAGGGGAAGAAGGAAGAGGG + Intergenic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1049733292 8:144190144-144190166 ATGCAGAGGCAGGAGGAAGATGG - Intronic
1050033593 9:1412072-1412094 CTGATGAGGAAGCCAGAAGAGGG + Intergenic
1050139703 9:2504545-2504567 CTGAAGAAGAGGTAGGACGAAGG - Intergenic
1050266467 9:3895692-3895714 ATGAAGATGAACAGGGAAGATGG - Intronic
1050475917 9:6040967-6040989 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1050606154 9:7303525-7303547 AAGGAGAGGAAGAAGGGAGAGGG + Intergenic
1050910619 9:11065000-11065022 CTGACGAAGAAAAGGGAAGATGG - Intergenic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051481365 9:17564788-17564810 CTGAAAAGGAACAAGGGGGAAGG + Intergenic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1051767830 9:20543715-20543737 CGGAGGAGGAAGGAGGAAGGAGG + Intronic
1051923106 9:22290967-22290989 ATGAAGATAGAGAAGGAAGAAGG + Intergenic
1051986245 9:23091097-23091119 TAGAAGAGAAAGAAAGAAGAAGG + Intergenic
1052349553 9:27444357-27444379 CTGAAGAGGTGGAAGAAAGCAGG - Intronic
1052387686 9:27841264-27841286 ATAAAAAGGGAGAAGGAAGAAGG - Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052668143 9:31520282-31520304 TTGAAGAGAAAGAAGAAAAACGG + Intergenic
1052976781 9:34417030-34417052 GGGAAGGGGAAGAAGGAGGAGGG - Intronic
1052987922 9:34501731-34501753 CTGAGGAGGAGGCAGGAAGGGGG - Intronic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053288150 9:36863057-36863079 CTCAAGAGAAGGAAGGAACAAGG + Intronic
1053946410 9:43313160-43313182 GGGAAGAGGAGAAAGGAAGATGG + Intergenic
1055142344 9:72889847-72889869 CAGAAAAGTAAGAAGGAAGGTGG - Intergenic
1055266060 9:74497499-74497521 AAGAAGAGGGAGAAGGAACAAGG - Exonic
1055378040 9:75671798-75671820 TTGAAGAAGAAGAGGGAAGGGGG + Intergenic
1055955868 9:81773049-81773071 CTGAAGAGGTAGTTGGTAGAGGG + Intergenic
1056040759 9:82664050-82664072 CTAAAAAGAAAGAAGGAAGGTGG + Intergenic
1056041663 9:82674515-82674537 CTGAAGAGGAACAATGAACCAGG + Intergenic
1056069739 9:82973761-82973783 TGGAAGGGAAAGAAGGAAGAGGG - Intergenic
1056206465 9:84323992-84324014 GAGAAGAGGAAGAAAGAAGTAGG - Intronic
1056608016 9:88103357-88103379 AAGAGGAGGAAGATGGAAGATGG - Intergenic
1057310943 9:93942915-93942937 AGGAGGAGGAGGAAGGAAGAGGG - Intergenic
1057453526 9:95187320-95187342 ATGAAGAGGGAGAAGGGAGAAGG - Intronic
1057474727 9:95388704-95388726 ATGAAGAGGGAGAAGGGAGAAGG + Intergenic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057890257 9:98864578-98864600 CTGCAGATGGAGAAGGAAGGAGG - Intergenic
1058376743 9:104330799-104330821 GAAAAGATGAAGAAGGAAGAAGG + Intergenic
1058563028 9:106249893-106249915 CAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058858641 9:109092111-109092133 CTGAAGAGAAAGAATGAGAAAGG - Intronic
1059303396 9:113333950-113333972 AGGAGAAGGAAGAAGGAAGAAGG - Intronic
1059339241 9:113588115-113588137 CTGCAGGGGAGGAAGGAAGCAGG - Intronic
1059396211 9:114035583-114035605 AGGAAGAGGAAAAAGAAAGAGGG - Intronic
1059431215 9:114251436-114251458 CAGAAGGGGAAGGAGGAGGAGGG - Intronic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1059860672 9:118457564-118457586 CTGGAGGGGATTAAGGAAGAGGG - Intergenic
1059923246 9:119180890-119180912 GGGCAGAGGAAGATGGAAGAAGG + Intronic
1059955461 9:119511172-119511194 AAGAAGAGGAAGAAGGTTGAGGG + Intronic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060921313 9:127422494-127422516 CTGAGGTGGCAGAAGGAAGATGG - Intergenic
1060976854 9:127770173-127770195 ATGAAGAGGAAGGAGGGAGGAGG - Intronic
1061077008 9:128347917-128347939 CTGAAAGGGGAGAGGGAAGAAGG + Intronic
1061802998 9:133122169-133122191 CTGAAGGGGAAGCAGGGACAGGG + Intronic
1061839805 9:133352023-133352045 CTGAAGGGGAGGAAGCCAGAGGG + Intronic
1061910387 9:133719268-133719290 CAAAAGGGGAAGAAGGAAGAAGG + Intronic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1062025072 9:134336453-134336475 ATCAAGACGAAGAGGGAAGAAGG - Intronic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062638472 9:137504051-137504073 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1203704821 Un_KI270742v1:29992-30014 CTGTAGAAGAAGGAGGAACAGGG + Intergenic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1203589540 Un_KI270747v1:41718-41740 GGGAAGAGGAGAAAGGAAGATGG + Intergenic
1185814986 X:3146313-3146335 AAAAAGAAGAAGAAGGAAGAGGG - Intergenic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1186290154 X:8088721-8088743 CTGAAGGGGAAGAAAGAACCAGG - Intergenic
1186402630 X:9273776-9273798 GGAAAGAGGAAGAAGGAAGGAGG + Intergenic
1186402651 X:9273894-9273916 TGGAGGAGGAAGAAGGAAGTAGG + Intergenic
1186402687 X:9274100-9274122 GGGAAAAGGAAGAAGGAAGTAGG + Intergenic
1186470559 X:9818761-9818783 GTGAAGAAAAAGAAAGAAGAGGG - Intronic
1186471176 X:9823145-9823167 GAAAAGAAGAAGAAGGAAGAAGG - Intronic
1186490751 X:9970337-9970359 AAGAAGAGAAAGAGGGAAGAAGG - Intergenic
1186570231 X:10707292-10707314 CGGAAGGGGAAGAAAGAATATGG + Intronic
1186643781 X:11484499-11484521 AGGAAGAGAAAAAAGGAAGAAGG + Intronic
1186693860 X:12007994-12008016 CTGAAGAGGAAACAGGAAATGGG + Intergenic
1186705650 X:12137609-12137631 TTCAAGAGGAAGAAGAAAAAGGG + Intergenic
1186840683 X:13482028-13482050 CTGGAAAGGAACAAGGAAAAAGG - Intergenic
1187025681 X:15433646-15433668 AAGAAGAGGAAGGAGAAAGAAGG + Intronic
1187025743 X:15433919-15433941 AGGAGGAGGAAGGAGGAAGAAGG + Intronic
1187207278 X:17195145-17195167 CTGAAGAGAGAGCATGAAGAAGG - Intergenic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188312147 X:28630516-28630538 CTGAAGGGGAAGAAGGCAGACGG - Intronic
1188515864 X:30985284-30985306 ATAAAGAGGAAGCCGGAAGATGG + Intergenic
1188519288 X:31020108-31020130 CTGAAGAGGAGGAATAAGGAGGG + Intergenic
1189206468 X:39243508-39243530 CTGAACAGGGAGTAGGGAGACGG - Intergenic
1189237828 X:39501859-39501881 CTGAAAAAGAAAAAGGCAGAAGG + Intergenic
1189330838 X:40144072-40144094 CTGGAGGGGAAGAGGGAAGGTGG + Intronic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1189512204 X:41674071-41674093 CAGAGGAGGAAGAAAGAGGAAGG + Intronic
1189551872 X:42101851-42101873 TTGATGTGGAGGAAGGAAGAGGG + Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189765954 X:44372427-44372449 CTGAAGGGGATAAAGGAGGAAGG - Intergenic
1189863719 X:45300924-45300946 TTGAAAAGGAAAAGGGAAGATGG + Intergenic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190222392 X:48520745-48520767 ATAAAAAGGAAGAAGGAAGGCGG - Exonic
1190311857 X:49122564-49122586 AAGAAGAGGAAGAAGGTGGAAGG - Intronic
1190589222 X:51980894-51980916 TTGAAAAGGAAGAACGAAGTTGG - Intergenic
1190781297 X:53598472-53598494 CTGAGGAGGAGGAAGGAAGTGGG - Intronic
1190831550 X:54063407-54063429 AAGAAGAGGAAGAAGTAAGATGG + Intergenic
1190884280 X:54517706-54517728 CTGAAAAGAAAGAACGATGATGG + Intergenic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1191880066 X:65836989-65837011 CAGAAGAGGAAGAAGGCCCAGGG - Intergenic
1191885639 X:65885042-65885064 CTGAGGATGCAGCAGGAAGATGG + Intergenic
1191961752 X:66711109-66711131 AGGAACAGGAAGTAGGAAGAGGG - Intergenic
1191979867 X:66913833-66913855 CTGAAGAGAAAGCAGGCAGAGGG - Intergenic
1192131330 X:68554009-68554031 CTGAGGAGGAAAAAAGAAAAAGG - Intergenic
1192235302 X:69291757-69291779 AGGAAGAGGAAGAAGCAAAAGGG - Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1192459496 X:71304777-71304799 ATGAAAAGGGAGAAGGAAGAGGG - Intronic
1192616809 X:72633365-72633387 CTGCAGAGGATGAAGCAACAAGG + Intronic
1192800664 X:74462048-74462070 GGGAAGAGGAGGCAGGAAGAGGG - Intronic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193103018 X:77636992-77637014 AGGAGGAGGAAGGAGGAAGAAGG + Intronic
1193459166 X:81769609-81769631 CAGAAGAGGAAGGGGGACGAGGG + Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193622280 X:83770298-83770320 CTGTAGGAGAAGAAGAAAGAAGG - Intergenic
1193738695 X:85191780-85191802 CTGAGGAGGAGGAAGAAAAAAGG + Intergenic
1193920801 X:87423727-87423749 CTTAATAGGAAAAAGGAAGTGGG - Intergenic
1194795518 X:98207409-98207431 CTGAAGAGGAGGAAGGGAAGTGG - Intergenic
1194839007 X:98715493-98715515 CTGTAGTGGCAGAAGGTAGAGGG + Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195520385 X:105822566-105822588 CTGGAGACGAAGAAGCTAGAAGG - Exonic
1195703438 X:107721871-107721893 CTGAAGAGGCTGGAGGAATAAGG + Intronic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196181605 X:112698169-112698191 CTGAAGGGCCAGAAGGAAGGCGG - Intergenic
1196581108 X:117380087-117380109 CACAAGAAGAAAAAGGAAGATGG + Intergenic
1196583469 X:117402402-117402424 CTCAAAATGGAGAAGGAAGATGG - Intergenic
1196934205 X:120713423-120713445 CAGAACAGGAAGAAGAGAGAAGG - Intergenic
1197950479 X:131890662-131890684 CAGAGGAGGAAGAGGAAAGATGG - Intergenic
1198256007 X:134924965-134924987 TTGCCAAGGAAGAAGGAAGAAGG + Intergenic
1198978011 X:142359021-142359043 CAGAAGAAGATGAAAGAAGAAGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199286010 X:146054905-146054927 AGGAAGAGGAAGGAGGAGGAGGG + Intergenic
1199489208 X:148380158-148380180 CTGAAAAGGAAGAAGGTGAAGGG + Intergenic
1199513947 X:148654831-148654853 CTCAAGCTGAAGAAGGAATAAGG + Intronic
1199599764 X:149534993-149535015 ATGAGGAGGAAGAAGAAAGAAGG - Intergenic
1199696863 X:150348762-150348784 TTGAAGTGGAAGAAGAAAGAGGG - Intergenic
1199751538 X:150824078-150824100 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751568 X:150824223-150824245 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751575 X:150824249-150824271 AGGAGGAGGAAGAAGGAAGGAGG + Intronic
1199751588 X:150824326-150824348 GAGAAGAAGAAGAAGAAAGAAGG + Intronic
1199849416 X:151714810-151714832 AGGAAGAGGAGGAAGGAAGGAGG - Intergenic
1200128357 X:153828793-153828815 CCGAAAAGGAAGCAGGAGGATGG + Intronic
1200812357 Y:7499272-7499294 ATGATGAGGAAGAAGGAAGAAGG - Intergenic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic
1201645534 Y:16225822-16225844 CTGAGGAGGAAGAAGGGAAAGGG + Intergenic
1201657279 Y:16359492-16359514 CTGAGGAGGAAGAAGGGAAAGGG - Intergenic