ID: 1049048139

View in Genome Browser
Species Human (GRCh38)
Location 8:140169280-140169302
Sequence GGAGGTAACAAGTGTTGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049048132_1049048139 17 Left 1049048132 8:140169240-140169262 CCACTTCACATCCACTAGGATGG 0: 23
1: 182
2: 571
3: 1097
4: 1753
Right 1049048139 8:140169280-140169302 GGAGGTAACAAGTGTTGGTAAGG No data
1049048130_1049048139 30 Left 1049048130 8:140169227-140169249 CCACAGTGAAGCACCACTTCACA 0: 1
1: 2
2: 41
3: 278
4: 1481
Right 1049048139 8:140169280-140169302 GGAGGTAACAAGTGTTGGTAAGG No data
1049048134_1049048139 6 Left 1049048134 8:140169251-140169273 CCACTAGGATGGCTACAATAACA 0: 1
1: 10
2: 137
3: 488
4: 1331
Right 1049048139 8:140169280-140169302 GGAGGTAACAAGTGTTGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049048139 Original CRISPR GGAGGTAACAAGTGTTGGTA AGG Intronic
No off target data available for this crispr