ID: 1049049093

View in Genome Browser
Species Human (GRCh38)
Location 8:140178656-140178678
Sequence TTCTTTCAGAAAGTAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 1, 2: 10, 3: 61, 4: 527}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049049093 Original CRISPR TTCTTTCAGAAAGTAGAGGA GGG (reversed) Intronic
900004259 1:34355-34377 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
900023986 1:204871-204893 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
900873515 1:5324398-5324420 TCTTTTCAGAAATTTGAGGAAGG + Intergenic
902628886 1:17692983-17693005 TCCTTCCAGGAAGTAGAGGGAGG + Intronic
902960117 1:19957371-19957393 TTCTTTAAGGAGGTAGTGGAGGG + Intergenic
906332368 1:44897384-44897406 TTTTTTCAAACAGTAGAGGTGGG + Exonic
907017224 1:51028620-51028642 CTCTTTCAGAAAATAGAAGAAGG + Intergenic
907908170 1:58803791-58803813 TTCTTTCAGAAACTAAGGGAAGG - Intergenic
908339671 1:63163838-63163860 TTCTTTTAGTAAGTTGAGGAGGG + Intergenic
908400014 1:63763063-63763085 CTCTTTCACAAAAGAGAGGAGGG - Intergenic
908961592 1:69703905-69703927 TTCTTTCAGAAACTTGAAAAAGG + Intronic
909388048 1:75082935-75082957 TTATTGCAGAAAGGAAAGGAGGG + Intergenic
910015701 1:82520593-82520615 CTGATTCAGAAAGTATAGGATGG - Intergenic
910437570 1:87220651-87220673 TTCTTTCATATGGTAGAGGGAGG - Intergenic
910598079 1:89001027-89001049 TTCTTTCAGAAAATATAAAAGGG - Intergenic
910760187 1:90725293-90725315 TTCTTTCAGAAATTCCAGGGTGG + Intergenic
911207165 1:95103465-95103487 TTCCTGTAGAAACTAGAGGAAGG + Intergenic
911329372 1:96509602-96509624 CACTTCCAGAAAGTAAAGGAGGG + Intergenic
912071631 1:105817654-105817676 TTCCTTTAGAAAGTCCAGGAAGG + Intergenic
912966507 1:114241728-114241750 TTCTTTGAGAATGTTGAGGCCGG - Intergenic
913037914 1:114991260-114991282 TTCTTCCAAAAAGTTGAAGAAGG + Intronic
914817473 1:151073620-151073642 TTGCTTGAGAAAGTAAAGGAAGG + Intronic
915012722 1:152703783-152703805 TTCTTTCAGAAAATAGAAGTAGG - Intergenic
915236812 1:154489343-154489365 GTTTTTCAGAAATTAGACGACGG - Exonic
917534844 1:175866957-175866979 TTGTTTCAGAAAGCACAGGCTGG + Intergenic
917715053 1:177726565-177726587 GTCTTTCAGAAGGTGGAGGGTGG + Intergenic
919301704 1:195777489-195777511 CTCTTTCATAAATAAGAGGAAGG + Intergenic
921093483 1:211865453-211865475 CTCTTTCAAAAAATAGAAGAGGG - Intergenic
921104474 1:211961723-211961745 TTCTTTAAGAATGTTGAGGCCGG - Intronic
921329034 1:214016998-214017020 TTCTTTAAGAATGTTGAGAAAGG - Intronic
921419999 1:214935500-214935522 TTCTTTCAGAAAGTTGATGGGGG - Intergenic
921780749 1:219160118-219160140 TTCATTCTGATAGTACAGGAAGG + Intergenic
922032504 1:221815309-221815331 TTCTATGAGAAAGGTGAGGAAGG + Intergenic
922217689 1:223533964-223533986 CTCTACCAGAAAGGAGAGGAGGG - Intergenic
922568942 1:226620955-226620977 TTTTTCCAGAAAGTAGAAGGCGG - Intergenic
922593063 1:226793141-226793163 TTCTGAAAGAAAGGAGAGGAAGG + Intergenic
922678413 1:227568467-227568489 TTCTTTGAGAACATAAAGGATGG + Intronic
924469482 1:244328384-244328406 CACTTTCAGAAAATAGAGGAGGG - Intergenic
1062800731 10:377785-377807 TACTTTCAAAAACTAGAAGATGG + Intronic
1064002709 10:11676907-11676929 TTCTTTGTGAAAGTAGATGGTGG - Intergenic
1064235605 10:13571440-13571462 TTCTTCCAGAAAATATAAGAGGG - Intergenic
1064463541 10:15557522-15557544 TTTTTTTAAAAAGTAGAGGCTGG + Intronic
1065202681 10:23329936-23329958 TTATTTCAGGAAGTCAAGGATGG + Intronic
1065218480 10:23473161-23473183 TTATCTCAGTAAGCAGAGGAAGG + Intergenic
1065609218 10:27454674-27454696 TTCTTTCAGAAGGGAGAAGGAGG + Intergenic
1066365872 10:34776561-34776583 TTTTTTTAGTAAGCAGAGGAAGG + Intronic
1066753582 10:38686211-38686233 TTATTTCAAATATTAGAGGATGG - Intergenic
1067197142 10:44131798-44131820 CTCTTTCATAAAATAGAAGAGGG + Intergenic
1067350092 10:45467714-45467736 TGCTTTCAGAAAGAGCAGGACGG - Intronic
1067516829 10:46955527-46955549 TTCTTTCAAAGAGTACAGTATGG + Intronic
1067645422 10:48096299-48096321 TTCTTTCAAAGAGTACAGTATGG - Intergenic
1067729666 10:48801027-48801049 TTCTTTAAGAAACCAGAGGCTGG - Intronic
1067807850 10:49405660-49405682 GCCTTTCAGAAAACAGAGGAGGG + Intergenic
1068756067 10:60654813-60654835 CTCTTTGAGAAAATAGAGGAAGG - Intronic
1069591326 10:69644121-69644143 TTCTTTCAGACTACAGAGGAGGG + Intergenic
1069714290 10:70510608-70510630 TTCTTTCAGGAAGGAGCAGAGGG - Intronic
1069837498 10:71318678-71318700 TTCTTTAAGAAAGCAGGGGCCGG - Intergenic
1070472300 10:76794098-76794120 TTGTTTCAGAGAATAGAAGATGG - Intergenic
1070763410 10:79040585-79040607 TTCTTTCAAACCATAGAGGATGG + Intergenic
1070938248 10:80318821-80318843 TTCTTTCAAAAAGCACAGCATGG + Intergenic
1071246261 10:83768107-83768129 TTCTTCCAGAAAACAGAAGAGGG - Intergenic
1073660244 10:105467769-105467791 TTCTTTGAGGAAGGTGAGGATGG + Intergenic
1073665797 10:105532363-105532385 GTCTTTCAAAGAGTAAAGGAGGG + Intergenic
1073685766 10:105752029-105752051 TTCTTTTAGTAAGTAGAAGTTGG - Intergenic
1073917292 10:108420399-108420421 GTCTTTCAGAAAATAGTGGTTGG - Intergenic
1074006754 10:109433585-109433607 TTCTTTCAGAAATGAGAGCCAGG + Intergenic
1074646888 10:115464790-115464812 TTTTTTATGAAAGTAAAGGATGG - Intronic
1075869103 10:125755530-125755552 CTCTTTCAGAAAACAGAAGAGGG - Intronic
1076153376 10:128183044-128183066 CTCTTTCAGAAAATAGAAGAGGG - Intergenic
1076315813 10:129540718-129540740 CTCTTTCAGAAAATAGAAGAGGG - Intronic
1077385493 11:2267712-2267734 TTCCTTCAGAAAGGAGTGGTTGG - Intergenic
1077955406 11:7013825-7013847 TTATTCCAGAAAGAAAAGGAAGG + Intronic
1078124701 11:8549524-8549546 CTATTTCAGAAAATTGAGGAGGG - Intronic
1078526618 11:12106345-12106367 GTCTTTCGGAAGGAAGAGGAAGG - Intronic
1078804401 11:14682853-14682875 TCATTTCTGAAAATAGAGGAGGG - Intronic
1078965740 11:16339380-16339402 TAATTTCAGAAAGTAAAAGATGG - Intronic
1079142709 11:17823411-17823433 TGCTTTCAAAGAGTAGAGCATGG - Intronic
1079164888 11:18031047-18031069 ATCTTTCTGAAATTAGATGATGG - Intronic
1079360716 11:19768181-19768203 TTCCTTGAGAAAGCAGAGGCAGG + Intronic
1079755879 11:24261146-24261168 TACTTTCATAACCTAGAGGAAGG + Intergenic
1080053194 11:27877884-27877906 TTCTTTCAGAAACTAGAAATTGG - Intergenic
1080379320 11:31751384-31751406 ATTTTTCAGAAAGTAGAGTTGGG - Intronic
1081001137 11:37673826-37673848 TTTTTTCAGTAAGTATAGAATGG - Intergenic
1081201743 11:40224888-40224910 TTCTGTCTGACAGCAGAGGATGG - Intronic
1082774481 11:57235042-57235064 TTCTCATAGAAAATAGAGGAAGG + Exonic
1082985265 11:59163637-59163659 CTGTTTCAGAAAATAGAAGAGGG + Intergenic
1083501516 11:63113557-63113579 TTCTTTAAGAATGTTGAGGCCGG + Intronic
1084112861 11:67024725-67024747 TTATCTCAGAAAGCGGAGGAGGG + Intronic
1084898352 11:72292216-72292238 GTCTTTCAGGAAGCAGAGAATGG - Intergenic
1085936430 11:81151444-81151466 TTCTTTGAGAGAGAAGAGGAAGG + Intergenic
1086259467 11:84921698-84921720 TCCTTTCAAAAAGATGAGGAGGG + Intronic
1086398168 11:86438509-86438531 CTCTTTCAGAAAATAGGGGAGGG - Intergenic
1087154557 11:94887569-94887591 TCTTTTCAGAAAGGAAAGGAAGG - Intergenic
1087709789 11:101535157-101535179 TTCTGTCAGAAAGAAAAGAAAGG + Intronic
1088925719 11:114299555-114299577 CTCTTTCAGAAAATAGAAGAGGG - Intronic
1089182330 11:116591579-116591601 TTCTTCCAGAAACTGGAGGATGG - Intergenic
1089378587 11:118012018-118012040 TTCTAGCAGATTGTAGAGGAAGG - Intergenic
1089472894 11:118735138-118735160 TTTATTAAGAAAGTAAAGGAGGG - Intergenic
1090058349 11:123442467-123442489 TTTATTAAGAAAGTAAAGGAAGG + Intergenic
1090716824 11:129438495-129438517 TCCTATCAAAAAGTAAAGGAAGG + Intronic
1091369003 11:135043228-135043250 TTTTCACAGAAAGTACAGGATGG + Intergenic
1091377682 12:36403-36425 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1092068098 12:5609207-5609229 TTCTGTCAGAAAGCAGGGAACGG + Intronic
1092274978 12:7053799-7053821 TTCTTTAAGAATGTTGAGGCCGG + Intronic
1092875556 12:12844382-12844404 ACCTTTCAGAAAATAGAGAATGG - Intergenic
1093263092 12:16965165-16965187 GTCTTTCAGAGGGTAGAGGGTGG + Intergenic
1093637923 12:21493708-21493730 TTGTTTCAGAAAGGGGAGGCAGG - Intronic
1093802540 12:23390810-23390832 TTCTTTAAGAATGTTGAGGCCGG - Intergenic
1094698434 12:32844694-32844716 TCTTATCAGAAAGTAGATGAGGG + Intronic
1095163640 12:38945675-38945697 CTATTTCAGAAAACAGAGGAGGG + Intergenic
1095367412 12:41424109-41424131 TTTTTTCACAAAGCAGAGTAGGG - Intronic
1095632721 12:44397198-44397220 TTGTTTCAGAAATTAGTGCAGGG - Intergenic
1095930367 12:47619637-47619659 TGCTTTCTCAAAGTAGAGAAAGG + Intergenic
1096582073 12:52592127-52592149 AGCTTTCAGAGAGCAGAGGAAGG - Intronic
1097145278 12:56935624-56935646 TTCCTTAACAAAGTAGGGGAGGG + Intergenic
1097256263 12:57677361-57677383 ATCTTTGACAAAGAAGAGGAGGG + Intergenic
1097367400 12:58732254-58732276 TGTTTTCGGAAATTAGAGGAGGG + Intronic
1097727607 12:63092898-63092920 TACTTTCAGAAAGTAAATGGTGG + Intergenic
1097744575 12:63287000-63287022 TTCTTCCAGAAAATACAGTATGG - Intergenic
1098027117 12:66215356-66215378 TTCTTTAAGAAAGAAAGGGAAGG - Intronic
1098538984 12:71630190-71630212 TGTTTTCAAAAAATAGAGGAAGG - Intronic
1100835230 12:98560792-98560814 TTCTTTGAGAAGGCAGAGGCAGG + Intergenic
1101082188 12:101198736-101198758 CTATTTCAGAAAATGGAGGAGGG + Intronic
1101497721 12:105271319-105271341 CTCTATCAGAAACTAGAGAAGGG - Intronic
1101748888 12:107566272-107566294 TCCTTTGAGGAAGTAGGGGATGG - Intronic
1101830063 12:108249937-108249959 TTCTTTCATGAAGCAGTGGAGGG + Exonic
1101938228 12:109077264-109077286 ATCTTTCAGTAAACAGAGGAAGG - Intronic
1102445996 12:113003200-113003222 TACCTTCAGAAACTTGAGGAAGG + Intronic
1102851787 12:116253407-116253429 CTCTTTCAGAAAACAAAGGAGGG + Intronic
1105238905 13:18592233-18592255 TTCTTCCAAAAAATAGAAGAAGG - Intergenic
1105787333 13:23762556-23762578 TTCTTACAGAAAGAGGAGAACGG - Intronic
1106147337 13:27061560-27061582 CTCTTTCAAAAAGTTGAAGAGGG + Intergenic
1106334848 13:28774895-28774917 TTCTTTAAGAATGTTGAGGCTGG + Intergenic
1106336368 13:28787187-28787209 TTCTTTAAGAATGTTGAGGCTGG + Intergenic
1107080537 13:36369994-36370016 TTCTTTCAGAAGGTATTGGGCGG - Intronic
1107369215 13:39724162-39724184 TACTTTTAGAAAGTACAGAAAGG - Intronic
1107783071 13:43925943-43925965 TTGTAGCAGAAAGTGGAGGATGG - Intergenic
1108784432 13:53878189-53878211 GTCTATCAGAAGGTGGAGGATGG - Intergenic
1109558003 13:64006097-64006119 TTCTTTCTTAAAGAAGAGAAAGG + Intergenic
1109872851 13:68358275-68358297 TTCTTAAAGAAAGTAGTGGTAGG + Intergenic
1111061851 13:83030434-83030456 GTCTTTCAGAGAGTAGATGGTGG + Intergenic
1111087117 13:83390810-83390832 TTCTTTCAAAAATTGGAAGAAGG + Intergenic
1111474556 13:88727318-88727340 GTCTTTCAGAGGGTAGAGGGTGG - Intergenic
1111776740 13:92672875-92672897 GACTTTCAGAGAGTAGAGGCAGG + Intronic
1112064070 13:95773002-95773024 CTCTTTCAGAAAATAGAGGAGGG - Intronic
1114056714 14:18975194-18975216 GTCTTTCAATAAGTAGAGGATGG + Intronic
1114105836 14:19426545-19426567 GTCTTTCAATAAGTAGAGGATGG - Intronic
1114552025 14:23538254-23538276 TTCTTTCCTAAAGAGGAGGAGGG - Intronic
1114811094 14:25900577-25900599 GTATTTCAGGAAGTAGAGGTAGG + Intergenic
1115197245 14:30814623-30814645 TTCTTTCAGAAATTTGATTATGG - Intergenic
1115381222 14:32741911-32741933 TTATTCCAAAAAATAGAGGAGGG - Intronic
1115619892 14:35131241-35131263 TTCAATCAGAAAGAAAAGGATGG - Intronic
1115854324 14:37613521-37613543 TTCTTTCAGCAAATAGAGGAGGG - Intronic
1115954854 14:38766174-38766196 TTCTTTAAGAATGTTGAGGCCGG - Intergenic
1116060246 14:39914822-39914844 TTCTTTTAAAAGGAAGAGGACGG - Intergenic
1116528669 14:45938541-45938563 TTCTCTGAGAAAGAAAAGGAAGG - Intergenic
1116927649 14:50656741-50656763 TGCTTTCAGAAAGTACAGCTGGG - Intronic
1117261515 14:54039092-54039114 GTCTTTAAGAAAGTACAGAAAGG + Intergenic
1117498412 14:56328623-56328645 TTCTGTTAGAAAGGAGGGGATGG + Intergenic
1117502894 14:56372297-56372319 TTCTTTAAGAATGTTGAGGCCGG + Intergenic
1117820111 14:59640082-59640104 CTCTTTCAGCAAATACAGGAGGG - Intronic
1117967156 14:61217838-61217860 TTCTTTTAAAAAGTAGAAGAGGG - Intronic
1118027653 14:61786049-61786071 TTCTTTCAGAAAATGCAAGAGGG + Intronic
1118401816 14:65386588-65386610 ATGTTCCAGAAAGTAGAGGAAGG - Intergenic
1118526662 14:66652112-66652134 GTCTTTCAGAATATAGAGGGGGG + Intronic
1118883345 14:69847205-69847227 TCCTTCCAGAAAGTACAGCATGG - Intergenic
1119569130 14:75654606-75654628 TTCTTTCATAAAGAAGTGGAGGG + Intronic
1120822288 14:88923095-88923117 TTCATGGAGATAGTAGAGGATGG - Intergenic
1121034188 14:90685954-90685976 CTCTTTCAAAAAGAAGAGGAGGG + Intronic
1121519603 14:94577043-94577065 TTCATTCTGTAAGTAAAGGAGGG - Intronic
1122411417 14:101527929-101527951 TTCTTCCACAAAGAGGAGGAAGG + Intergenic
1123498709 15:20859042-20859064 GTCTTCCAATAAGTAGAGGATGG - Intronic
1123555943 15:21432670-21432692 GTCTTCCAATAAGTAGAGGATGG - Intronic
1123592185 15:21870003-21870025 GTCTTCCAATAAGTAGAGGATGG - Intergenic
1123929434 15:25155426-25155448 TTCTTTCAAAGAGTACAGGGTGG + Intergenic
1125133919 15:36318459-36318481 TTCTTTCAGAAGATAGAGGAAGG - Intergenic
1125943841 15:43697607-43697629 TCCTTTCAGACAGAAGATGAAGG - Intronic
1126059204 15:44762743-44762765 TTTTTCAAGAATGTAGAGGAAGG - Intronic
1126166933 15:45661420-45661442 GTCTCTGAGAAAGTAGAAGAAGG + Intronic
1127621664 15:60740048-60740070 TTCTATTAGAAAGGAGAGAAAGG + Intronic
1128023019 15:64409362-64409384 AGCTTTCAGAAGGTAGAGGCTGG + Intronic
1128580580 15:68807169-68807191 TTCTTCCAGTGAGTTGAGGAGGG + Intronic
1130079391 15:80718954-80718976 TTCTTTAAAAAAATAGAAGAGGG - Intronic
1131618145 15:94038157-94038179 TTATTTCAAAAAATTGAGGAGGG + Intergenic
1131929347 15:97422160-97422182 CTCTTTCAAAAAATAGAGGAAGG + Intergenic
1132134597 15:99322726-99322748 TTCTTTCAGCAAGGAGATAATGG + Intronic
1132250442 15:100331979-100332001 TCCTTTCAGAACGTAGAGCTGGG - Intronic
1132449245 15:101956589-101956611 TTCTATGAGAAAGAAGGGGAGGG - Intergenic
1202964286 15_KI270727v1_random:159879-159901 GTCTTCCAATAAGTAGAGGATGG - Intergenic
1132561551 16:596978-597000 GTCCTTCAGAAATTAGCGGAGGG + Intronic
1132687290 16:1167716-1167738 TCCTTTCAGGAAGCAAAGGAGGG - Intronic
1133499902 16:6356213-6356235 TTCTTCCAGAGAGTACAGCATGG + Intronic
1133570865 16:7038679-7038701 TTCTTGCAGAAAGCAGATGTGGG + Intronic
1134415823 16:14042680-14042702 TTCTTTAAGAAAAGAAAGGAAGG + Intergenic
1135143939 16:19945310-19945332 TTGTTTCTGAAAGAAGAGAAGGG + Intergenic
1135156892 16:20060109-20060131 TTCTTTCAGGAGGCAGATGATGG + Intronic
1135660610 16:24293289-24293311 TTCTTTCCAGAAGGAGAGGATGG + Intronic
1135939489 16:26809200-26809222 TTCTCTCTGAAAATAAAGGATGG + Intergenic
1136729154 16:32390982-32391004 TTATTTCAAATATTAGAGGATGG + Intergenic
1137334933 16:47538811-47538833 AACTTTCAGAAACTACAGGAAGG - Intronic
1137469977 16:48745478-48745500 TTTTTTTAGAAAATGGAGGAAGG + Intergenic
1137572148 16:49573741-49573763 ATCTTTCTGAATGCAGAGGATGG - Intronic
1138153585 16:54682425-54682447 TTTTTTCAGGAAGTAAACGATGG - Intergenic
1138238175 16:55403314-55403336 ATCTTTCAGAAAGTAGATGATGG - Intronic
1139698336 16:68691302-68691324 TTTATTAAGAAAGTAAAGGAGGG - Intronic
1139831653 16:69803607-69803629 TTTGTTAAGAAAGTAAAGGAAGG + Intronic
1140049939 16:71471725-71471747 TTGTTCCAGACAGTAGAGGAAGG - Intronic
1140567930 16:76066153-76066175 TTCTTCCAAAAAGTATAGTATGG - Intergenic
1141024348 16:80530528-80530550 CTCTTTCAGAAAACAGAAGAAGG - Intergenic
1202997246 16_KI270728v1_random:126542-126564 TTATTTCAAATATTAGAGGATGG - Intergenic
1203023933 16_KI270728v1_random:438884-438906 TTATTTCAAATATTAGAGGATGG - Intergenic
1143459592 17:7093270-7093292 CTCTTCCAGAAAATAGAAGAGGG + Intergenic
1144826397 17:18107933-18107955 TTATTTCAGAAAGGAGAGCCAGG - Exonic
1145989739 17:29071858-29071880 TTCCTTCATAAAGTGGAGGAAGG - Intergenic
1146497514 17:33336248-33336270 TTCCTTCAGAGGGAAGAGGAAGG + Intronic
1146934605 17:36804984-36805006 TCCCTGCAGATAGTAGAGGAGGG - Intergenic
1147029852 17:37623971-37623993 TTCTATAAGAAACCAGAGGAGGG + Intronic
1147387229 17:40089722-40089744 TCCTCTCAGAAGGTAGGGGAAGG + Intronic
1147674266 17:42193880-42193902 CTCTTTCAGAAGGTAGGGGTGGG + Exonic
1148954871 17:51345361-51345383 ATCTTTTAGAACGAAGAGGAAGG + Intergenic
1149148765 17:53533409-53533431 TTCCTTCAGATAGTAGGGAATGG + Intergenic
1150817522 17:68404675-68404697 CCCTTTCAGAAAATAGAGAAGGG - Intronic
1150888256 17:69112858-69112880 TTTTTTCAGAAAGTATTGGAAGG - Intronic
1151168693 17:72227195-72227217 TTCTTCCAAAAACTAGAGTATGG - Intergenic
1151401103 17:73856679-73856701 TTGTTTCAAAATGTAGAGGAGGG - Intergenic
1151464152 17:74273819-74273841 TTATTACAGAAAGTGGAGGAAGG + Intergenic
1152540046 17:80970264-80970286 TTCTTTCCCAAGGTGGAGGAGGG - Intergenic
1152827145 17:82473852-82473874 TTATTTAAAAAATTAGAGGACGG - Intronic
1153479064 18:5528897-5528919 TTAATTAAGAAACTAGAGGATGG - Intronic
1154456757 18:14535822-14535844 GTCTTCCAATAAGTAGAGGATGG - Intronic
1154512305 18:15120065-15120087 TTCTTCCAAAAAATAGAAGAAGG - Intergenic
1154973060 18:21429564-21429586 TTTTTTCAAAAAGTAGAAGGAGG - Intronic
1155031089 18:21984475-21984497 TTTTTCCAGAAAATAGAAGAGGG + Intergenic
1155427154 18:25718288-25718310 TTCTTTAAGAATGTCGAGGCCGG - Intergenic
1155445581 18:25908754-25908776 CTTTTTCAAAAAATAGAGGAGGG - Intergenic
1155670916 18:28370177-28370199 TTCCCTCAGAAAGTAGAGGCTGG + Intergenic
1156114118 18:33766637-33766659 TCCTTTCAAAGAGTACAGGATGG - Intergenic
1156172376 18:34501496-34501518 CTCTTTCAGAAAATAGAAGAGGG - Intronic
1156531279 18:37818851-37818873 CTCTTTCAGAAGATAGAGAAGGG + Intergenic
1157773539 18:50372585-50372607 TTCTTCCTGAAAGCAGAAGATGG - Intergenic
1158264582 18:55647672-55647694 TTCATTCTGAAAGCCGAGGAGGG - Intronic
1158440695 18:57471754-57471776 TTCTTTCAAAAAGTGGGGAAAGG + Intronic
1158962751 18:62600293-62600315 TTCTTTCAGGAAGAAATGGAGGG + Intergenic
1159123414 18:64195949-64195971 TTCTTTTGGAAAGAAGTGGAAGG - Intergenic
1159188476 18:65010540-65010562 GTCTTTCAGAAGGTTGAGGGAGG - Intergenic
1159529629 18:69639288-69639310 TTCTCTAAGAGAGCAGAGGATGG - Intronic
1160636011 19:75964-75986 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1162695424 19:12470052-12470074 TTCTTTCTGAAATTGGAGAAAGG - Intronic
1163829936 19:19542779-19542801 TTCTGGGAGAAAGGAGAGGATGG + Intronic
1165284415 19:34829178-34829200 CTCTTTCAGAAAGTGGAGAAAGG + Intergenic
1166746153 19:45142800-45142822 TGCTTTCAGATGGGAGAGGAGGG + Intronic
1166979805 19:46625658-46625680 TCCTTCCAGAAAGCTGAGGAAGG + Intergenic
925507033 2:4578329-4578351 TTCTCTTAGAAAGTAGGGGAAGG - Intergenic
925655812 2:6147034-6147056 CTCTTTGAGTGAGTAGAGGAAGG + Intergenic
926222442 2:10944994-10945016 TTCTTTCAGACAGAAGTGCAAGG - Intergenic
926228796 2:10987251-10987273 GTATTCCAGAGAGTAGAGGACGG + Intergenic
926386591 2:12341407-12341429 ATATTTGAGAAAGGAGAGGAAGG - Intergenic
927106109 2:19828166-19828188 CTCTTTCAGAAAATAGAGAAAGG + Intergenic
928478158 2:31652506-31652528 TTATATCAGAAAGATGAGGAGGG + Intergenic
929901579 2:46008379-46008401 TTCATTTAGAAAGAAGATGAAGG + Intronic
930386582 2:50703432-50703454 TTATTTCAGAAGGTGGTGGAGGG + Intronic
930465434 2:51742353-51742375 TTATTTCAAAATGTAGAGCAAGG - Intergenic
930700314 2:54453842-54453864 TCCATTCAGAATGTAGGGGAAGG - Intergenic
931251130 2:60531335-60531357 TTCTTGCAGAACGCAAAGGAGGG - Intronic
933301356 2:80544857-80544879 TTCTTTCAGAAATAAGATAAGGG - Intronic
934185440 2:89668888-89668910 TTATTTCAAATATTAGAGGATGG + Intergenic
934316965 2:91931519-91931541 TTATTTCAAATATTAGAGGATGG - Intergenic
934482165 2:94661147-94661169 TTCATTGAGAAAGAAAAGGATGG + Intergenic
934576510 2:95405123-95405145 TTCCTCCAGAAACTAGAGAAGGG + Intronic
935381728 2:102458685-102458707 TTTTTTCAGAAAACAGAAGAAGG + Intergenic
935482363 2:103608166-103608188 CTCTTTCAGAGAATAGAAGAGGG + Intergenic
935551274 2:104458871-104458893 TTTTTTCAGAAGATAGAAGAGGG - Intergenic
935829301 2:106983735-106983757 TGCTTTCAAAAAGTAAAGTATGG - Intergenic
936023257 2:109011712-109011734 GTTTCCCAGAAAGTAGAGGAGGG - Intergenic
936565469 2:113579086-113579108 TTCTATGAGAAAGAAGGGGAGGG - Intergenic
936672119 2:114668790-114668812 TCCTATCAGAGAATAGAGGAGGG - Intronic
936810333 2:116391925-116391947 TTCTTCCAGACAGGAGTGGACGG + Intergenic
937015044 2:118597345-118597367 TTCTTACAAAAAGAAGAGGTTGG - Intergenic
937460407 2:122080367-122080389 TTATTGCTGAAAGGAGAGGAAGG - Intergenic
937848464 2:126608774-126608796 ATCTTTCTAAAAGTAGATGAAGG + Intergenic
938285590 2:130112934-130112956 GTCTTTCAATAAGTAGAGGATGG - Intronic
938430014 2:131225967-131225989 GTCTTTCAATAAGTAGAGGATGG + Intronic
938474834 2:131599149-131599171 GTCTTTCAATAAGTAGAGGATGG + Intergenic
938511868 2:131956833-131956855 TTCTTCCAAAAAATAGAAGAAGG - Intergenic
939225824 2:139362948-139362970 TTATTTTAGAAATAAGAGGAAGG - Intergenic
941394058 2:164952433-164952455 TTTTTGCAGAAAGTAGTAGATGG - Intronic
941470564 2:165880416-165880438 TTCTTTTAGAAGGAAGAGAAGGG + Intronic
941926610 2:170901709-170901731 TTCTTTCTAAAAGTTCAGGAAGG + Intergenic
942067688 2:172287034-172287056 GTCCTTTAGAAGGTAGAGGAAGG - Intergenic
942079759 2:172389006-172389028 TGCTTTGACAAAGTGGAGGAGGG - Intergenic
942759461 2:179381434-179381456 CTCTTACAGAAAGTTGAAGAAGG + Intergenic
943060154 2:183034682-183034704 TTGCTTCTGAAGGTAGAGGATGG - Intronic
944638634 2:201699204-201699226 ATATTGCAGAAAGGAGAGGAAGG + Intergenic
947035864 2:225854180-225854202 CTCTTTCAAAAAAAAGAGGAGGG - Intergenic
947074758 2:226330435-226330457 TTCTTTCTTAAAATAGAGAAGGG + Intergenic
948343322 2:237273014-237273036 TTCTTTAAGAATGTTGAGGCTGG - Intergenic
948392938 2:237625833-237625855 TTCTTTTAGAAAGGAGACGTTGG + Intergenic
1169466196 20:5842250-5842272 TTTTATCTGAAGGTAGAGGAAGG - Intronic
1169933466 20:10858290-10858312 CTCCATCAGAAAGCAGAGGAGGG - Intergenic
1170843714 20:19944705-19944727 TTCCATCTGAAAGTTGAGGATGG + Intronic
1171161683 20:22930780-22930802 TTCTTTCAGGAAAAAGAGGCAGG - Intergenic
1171447620 20:25215991-25216013 TTCTCTTAGAAATGAGAGGATGG - Intronic
1171791035 20:29525885-29525907 TCCTTTCAAAAAGTATAGAATGG + Intergenic
1173017381 20:39237843-39237865 TGCTTTCAGAAAGTAGTGTGAGG - Intergenic
1173203845 20:40975696-40975718 CTCTTCCAAAAAATAGAGGAGGG - Intergenic
1173373997 20:42466719-42466741 TTCTTTCAGTAGGTAGAGCTAGG - Intronic
1173667722 20:44774739-44774761 TCCTTTCAGAAAGGAGGGGAGGG - Intronic
1175417729 20:58812644-58812666 TTCCTTCAGAAAGCTGAGGAGGG + Intergenic
1175454388 20:59099986-59100008 GTCTATCAGAAGGTGGAGGAAGG - Intergenic
1176782901 21:13220492-13220514 TTCTTCCAAAAAATAGAAGAAGG - Intergenic
1176817404 21:13617508-13617530 GTCTTCCAATAAGTAGAGGATGG + Intronic
1176897174 21:14394241-14394263 TTCTTTCTGAAAGCAGAGTTTGG + Intergenic
1177410091 21:20718668-20718690 TACTTTAAGAAAGTACAGGCCGG + Intergenic
1177506525 21:22026885-22026907 TTTTTTCAGAAACCTGAGGAGGG + Intergenic
1177979606 21:27895092-27895114 TTCTTCCAAAAAATAGAAGAAGG + Intergenic
1178323936 21:31628184-31628206 GACTTTCAGAAAGAAGAGGGTGG - Intergenic
1178743897 21:35228881-35228903 TTCTTTGAGAAATTAGGAGATGG + Intronic
1179440723 21:41391977-41391999 ATCTGTCAGAAGGTGGAGGAGGG - Intronic
1180114389 21:45689036-45689058 TTTTTTCAGAAAATGGATGAGGG + Intronic
1180475199 22:15697807-15697829 GTCTTTCAATAAGTAGAGGATGG + Intronic
1180543324 22:16474032-16474054 TTATTTCAAATATTAGAGGATGG - Intergenic
1182454416 22:30440643-30440665 TTTATTAAGAAAGTAAAGGAAGG + Intergenic
1182909132 22:33965980-33966002 TTTTATCAGCAAGTAGAAGAGGG - Intergenic
1182945505 22:34317727-34317749 TCCTATCAGAGAGTAAAGGATGG + Intergenic
1183803563 22:40189108-40189130 TTACTTCAGCAAGTAGAAGATGG + Intronic
1184519058 22:44981672-44981694 CTCTCTCAGAAAGGAGGGGAGGG + Intronic
1184632815 22:45798126-45798148 CTCTTTCATAAAATAGAGGAGGG + Intronic
949512321 3:4777332-4777354 TCCTTTGGGAAAGAAGAGGATGG + Exonic
950402857 3:12783753-12783775 TTCTTTTGAAAAGTAGAGCATGG + Intergenic
953110178 3:39928278-39928300 ATCTTGCAGAAAATATAGGAGGG + Intronic
953855610 3:46497352-46497374 CTCTTGCAGGAAGCAGAGGATGG + Intergenic
954926082 3:54235866-54235888 TTCTTTCAAAGAGTACAGCATGG + Intronic
955800993 3:62686342-62686364 TTCTTTCAGAAAGTCAGGTAGGG + Intronic
956315617 3:67932824-67932846 CTGTTTCAGAAAATAGAAGAGGG + Intergenic
957006461 3:74953932-74953954 TCCTTTCAAAAAACAGAGGAAGG + Intergenic
958054547 3:88392587-88392609 TTCTTTCAAAAATTAAAGTAAGG + Intergenic
958723918 3:97880201-97880223 TTCTGTCGAAAAGTAGAGGAAGG - Intronic
958875817 3:99615920-99615942 GCCTTTCAGAAGGTAGAGGGTGG - Intergenic
959209896 3:103364703-103364725 GTCTTTCAGAGGGTAGAGGGTGG + Intergenic
959540475 3:107531778-107531800 CTCTTTAAAAAAGTAGAGTATGG + Intronic
959778561 3:110200418-110200440 TTCCTTCAGAAAGGAAAGGCAGG - Intergenic
959818721 3:110706081-110706103 CTCTTTCAAAGAATAGAGGAGGG - Intergenic
959836790 3:110927379-110927401 TTCTTGAAGAAAGAAAAGGAAGG + Intergenic
960148659 3:114230246-114230268 TGCTTTCAAAGAGTAGAGGCAGG + Intergenic
960679913 3:120237307-120237329 TTCTTTAAGAATGTTGAGGCCGG + Intronic
961065490 3:123871765-123871787 CTCTTCCAGAAAATAGAAGAAGG + Intronic
961436516 3:126922517-126922539 ATCTCTCAGAATGTACAGGATGG + Intronic
963054203 3:141171344-141171366 TTCTTTCAGAAAAAAATGGAGGG - Intergenic
963286768 3:143441236-143441258 TTCTACCACAAAGTGGAGGAAGG - Intronic
963506048 3:146186010-146186032 TTCTTTCAGAGGGCAGAGAATGG - Intergenic
965123096 3:164589046-164589068 TACTTTCAGAGGGTAGAGGGTGG - Intergenic
965505180 3:169507509-169507531 TGCTTTCAGAAAGAAGGGGTAGG + Intronic
966198377 3:177336176-177336198 TTGTATTAGAAATTAGAGGAAGG - Intergenic
966699930 3:182837776-182837798 TTGTTTCTGAAAGGAGAGAAAGG + Intronic
970117593 4:12716516-12716538 ACCTTTCAGAGAGTGGAGGATGG + Intergenic
970588537 4:17537957-17537979 TTACTTCAGAAAGTAAAGAATGG + Intergenic
970696498 4:18684574-18684596 TTCTTTTACCAACTAGAGGAGGG + Intergenic
971063789 4:23003936-23003958 TTTTTACAGAAAGAAGAGAAGGG - Intergenic
971400794 4:26273705-26273727 TTCTTCCTGAAAGTGGAGGAGGG - Intronic
971590042 4:28456000-28456022 TTCTTTAAGAATGTTGAGGCCGG + Intergenic
971843014 4:31878843-31878865 TTCTCTGAGTAATTAGAGGAAGG - Intergenic
972119330 4:35681144-35681166 TTCTTTAAGAATGTTGAGGCCGG + Intergenic
974148609 4:57976768-57976790 GTCTGATAGAAAGTAGAGGAGGG - Intergenic
974157024 4:58086695-58086717 GCCTTTCAGAAGGTAGAGGGTGG - Intergenic
974574003 4:63693011-63693033 TACCTTAAGAAAGTAGAGAAAGG + Intergenic
975105810 4:70567972-70567994 CTCTTCCAAAAAGTTGAGGAGGG - Intergenic
975115123 4:70671708-70671730 TTTTTTAAGAAAGTACAGGCTGG + Intronic
975172365 4:71246748-71246770 TTTTTCCAGACAGTGGAGGATGG + Intronic
976092958 4:81475779-81475801 TTCTTTAAGAATGTTGAGGCTGG - Intronic
976330425 4:83825124-83825146 TCCGGTCAGAAAGTTGAGGAAGG + Intergenic
977739758 4:100464909-100464931 CTCTTTTAGAAAGTAAAGGAGGG - Intronic
977948855 4:102946595-102946617 TTATTTCAAATATTAGAGGACGG - Intronic
978299135 4:107245939-107245961 TTGTTTCAGCAACAAGAGGAAGG - Intronic
978366270 4:107986256-107986278 TATTTTCAGCAAGTATAGGAAGG - Intergenic
978596409 4:110381617-110381639 TTCTTTCAGAATGTTGACTATGG - Intronic
978853367 4:113365280-113365302 TTTTTTCAGAAGGTAGACCATGG + Intronic
979355855 4:119704661-119704683 ACCTTTCAGAAAATAGAGGAAGG + Intergenic
979905796 4:126289987-126290009 TTCTTTCAGAATATAGAGGAGGG - Intergenic
981039760 4:140212313-140212335 TCCTGGCAGATAGTAGAGGAAGG - Intergenic
981736167 4:147953304-147953326 TTCTTCCATAAAATAGAAGAGGG - Intronic
982375357 4:154684489-154684511 TTAATTCAGAAAGTGGAGGTTGG + Intronic
982416391 4:155137543-155137565 CTCCTTCAGAACATAGAGGAAGG - Intergenic
982962896 4:161862793-161862815 TTCTTTCAGAAAAGAGACAAGGG - Intronic
983087329 4:163463140-163463162 TTCTTTCGAAAAGTAGAAAAAGG + Intergenic
983767863 4:171508616-171508638 TTCTTTGAGAATGTTGAAGAAGG - Intergenic
984274618 4:177595195-177595217 TGATTTCAGAAAGAAAAGGAAGG - Intergenic
984557484 4:181232614-181232636 TCCATTCAGAATGTAAAGGAAGG - Intergenic
984650222 4:182262970-182262992 TTTATTAAGAAAGTAAAGGAGGG - Intronic
984992142 4:185391356-185391378 TGCTTCCAAAAAGTAGAGTATGG - Intronic
985203597 4:187508592-187508614 TTTTTTAAAAAAGTAGAGGAAGG - Intergenic
985851660 5:2392855-2392877 TTCTCTAGGAAGGTAGAGGAAGG - Intergenic
986466357 5:8028896-8028918 CTCTTCCAGAAAATAGAAGAGGG - Intergenic
987292698 5:16523623-16523645 TGCTTTCAAAGAATAGAGGATGG - Intronic
987518137 5:18942420-18942442 TTCATTCAGAAAGTATTGGCCGG + Intergenic
990382058 5:55227953-55227975 CGTTTTCAGAAAGTGGAGGAGGG - Intergenic
991651408 5:68858768-68858790 TTTTTTCTCAAAGGAGAGGAAGG + Intergenic
991776517 5:70090549-70090571 TTCTTTATGAAAGAAAAGGAAGG + Intergenic
991855804 5:70965996-70966018 TTCTTTATGAAAGAAAAGGAAGG + Intergenic
991869819 5:71098774-71098796 TTCTTTATGAAAGAAAAGGAAGG + Intergenic
991902260 5:71472722-71472744 TTATTTCAGAAAATAGAAGAGGG - Intronic
992382556 5:76252508-76252530 TTCTTTCATAGATTAGAAGAAGG - Intronic
992835427 5:80636285-80636307 TTATTTTAGAAAGAAGAGGTAGG - Intronic
993208278 5:84914448-84914470 TCCTTCCAAAAAGTACAGGATGG + Intergenic
993726767 5:91377766-91377788 TTTTCTCAGAAATTAGATGAGGG + Intronic
994624621 5:102203003-102203025 TTCTTTCAGAAAATAAAAAAAGG + Intergenic
994771520 5:103987910-103987932 CTGATTCAGAAAGTAGAGGATGG + Intergenic
994781239 5:104093587-104093609 TTCATTCTGATAGAAGAGGATGG + Intergenic
994966442 5:106678747-106678769 TTCCATCAAAAAGTAGACGAAGG - Intergenic
995013761 5:107287462-107287484 TTCTTTAACAAAGCAGATGAGGG + Intergenic
995105699 5:108375728-108375750 TTCTTCCAAAAATGAGAGGATGG + Intronic
995436458 5:112141738-112141760 TTCTTTCAGAAAGTAACACAAGG - Intergenic
995907835 5:117147210-117147232 TTATTTCAGAAAGAACAGAATGG - Intergenic
995925859 5:117372695-117372717 CTTTTTCAGAAAATAGAAGATGG - Intergenic
996199410 5:120652378-120652400 TTCTTCCAAAAAGTACAGTAGGG + Intronic
996968838 5:129338733-129338755 TTGTTTCAGAAAGAACAAGAAGG - Intergenic
997591794 5:135078118-135078140 TTATTTTAGAGAGTAGAGGATGG - Intronic
997596436 5:135110288-135110310 TGCTTGCAGAAAGTAGAGGCAGG - Intronic
998290876 5:140913123-140913145 CTATTCCAAAAAGTAGAGGAGGG - Intronic
998294028 5:140948373-140948395 ACCTTTCAGAAAATAGAGGAAGG - Intronic
998509485 5:142699456-142699478 TCCTTTCATACAGTAGGGGAAGG - Intergenic
998515864 5:142753497-142753519 TTGTTTTAGTAAGTAGAGGCAGG - Intergenic
1000266990 5:159647337-159647359 TTGCTTTGGAAAGTAGAGGAGGG - Intergenic
1000559949 5:162774096-162774118 TTCTTCCAGAAAATATAAGAGGG - Intergenic
1001221803 5:169906759-169906781 TTCTTTCTGACAGTAAAGCAAGG - Intronic
1001459659 5:171899913-171899935 GACTTTCAGAAAGAAGAGGGTGG - Exonic
1002029810 5:176419460-176419482 TTTATTAAGAAAGTAAAGGAGGG - Intergenic
1002880014 6:1242906-1242928 TTCTTTCAGGAACTGGAGGCAGG - Intergenic
1003773298 6:9331888-9331910 TCCTTTAAGACAGAAGAGGAGGG + Intergenic
1004704343 6:18109869-18109891 TTCTATCAGAAAATAAAGGAGGG + Intergenic
1005273088 6:24187155-24187177 TTTTTTAAGGAAATAGAGGAGGG - Intronic
1006042274 6:31266492-31266514 TTCTTGCAGAAAGGAAAGGGAGG - Intergenic
1006123562 6:31822414-31822436 TTCTATCGGAAAGGAGAGGCAGG + Intergenic
1006709501 6:36054789-36054811 TTTTTTAAAAAAGAAGAGGAGGG - Intronic
1006878340 6:37317658-37317680 TTTTTTTAAAAAGTAGAGCAGGG + Intronic
1006968307 6:38012748-38012770 GCCTTTGAGAAAGTAGGGGAGGG + Intronic
1008038037 6:46766951-46766973 TCCTTCCAGAAAATAGAAGAGGG + Intergenic
1008293881 6:49753971-49753993 TTCTTTAAGAATGTTGAGGCTGG + Intergenic
1008862391 6:56164809-56164831 TTCTTTCAGAATGGAGAGGTAGG - Exonic
1009968309 6:70600971-70600993 TTCTTTTTTAAAGTAGAGAAAGG - Intergenic
1010125813 6:72430738-72430760 TTTTTTAAAAAAGTAGAGGCTGG + Intergenic
1010152226 6:72746414-72746436 TTCTTTCAGAAAGCACTGGGAGG + Intronic
1010620310 6:78065223-78065245 TTCTTCCAGACAGTACAGCACGG - Intergenic
1010725433 6:79327395-79327417 TTGTTGGAGAAAGGAGAGGAAGG - Intergenic
1011153832 6:84306537-84306559 GACTTTCAGAGGGTAGAGGATGG + Intergenic
1011236331 6:85222050-85222072 TTACTTCAAAAAATAGAGGAGGG + Intergenic
1011812092 6:91144445-91144467 TTCTTTCTGAAAGCAGTGAATGG + Intergenic
1012904646 6:105050304-105050326 TTCTTTAAGAATGTTGAGGCTGG + Intronic
1013007705 6:106089348-106089370 TTCCTTCAGAAAGTAGGGAAAGG + Intronic
1013179102 6:107703208-107703230 TTTATTAAGAAAGTAAAGGAAGG - Intergenic
1013538569 6:111085856-111085878 TTCTTCCAAAGAGTATAGGATGG - Intergenic
1014500987 6:122189156-122189178 GTCTTTCAGAAGGTGGAGGGTGG - Intergenic
1015047730 6:128797141-128797163 CTCTCTCAGAAAATAGAAGAGGG + Intergenic
1017435566 6:154412489-154412511 TTCTATCAGAAACTGGAGGAAGG - Intronic
1017518974 6:155185089-155185111 TTCCTGTAGAAAGTAGAGAAAGG + Intronic
1018998259 6:168726454-168726476 ACCTTTCAGAAAATACAGGATGG - Intergenic
1020988949 7:15171446-15171468 TCCTTTCAAAAAGTATAGTATGG - Intergenic
1021662195 7:22930578-22930600 TTCTTCCAAAAAATAGAGAAGGG + Intergenic
1021759582 7:23890675-23890697 ATCTTTCAGAGAGTGGAGGTTGG - Intergenic
1022269301 7:28790567-28790589 ATCTTTTTCAAAGTAGAGGAGGG - Intronic
1022584738 7:31596947-31596969 TTTTTTCATAAATTTGAGGATGG + Intronic
1023697516 7:42863423-42863445 TTCTTTAAGAATGTTGAGGCCGG + Intergenic
1023702910 7:42910737-42910759 TTCTTGCAGAAAGTAGAAGCTGG - Exonic
1024365441 7:48515362-48515384 TTATTTCAGGAAGGAGATGAGGG + Intronic
1024881723 7:54093992-54094014 TTGTTTCAGAATGTAGAAAAAGG - Intergenic
1026208297 7:68278991-68279013 TTATTTCATAAAGTGGAGAAAGG - Intergenic
1026904427 7:74054834-74054856 TTCTCTGGGCAAGTAGAGGAGGG - Intronic
1027939634 7:84658613-84658635 TTCTTTAAAAAAGTAAAGGCAGG - Intergenic
1028451142 7:90984611-90984633 TTCTTCCATAAAGCAGAGCAGGG + Intronic
1028643668 7:93072114-93072136 TTCTTTAAGAATGTTGAAGATGG + Intergenic
1028656312 7:93211813-93211835 GTCTTTCTGAGAGTAGAGCAAGG + Intronic
1028788750 7:94828393-94828415 CTCTTTCAGAAAATAGAGGAGGG - Intergenic
1028818064 7:95171771-95171793 CTCTTTCAGAACATAGAAGATGG + Intronic
1028852878 7:95556291-95556313 TTCTTTCAGGAAGTAGAACTAGG + Intergenic
1029020585 7:97360775-97360797 TGCATTGAGGAAGTAGAGGAAGG + Intergenic
1030062318 7:105632407-105632429 ATATTTCAGAAAGTAGAACAAGG + Intronic
1030135127 7:106239316-106239338 TTATATCAGTAGGTAGAGGAGGG - Intergenic
1030648550 7:112091812-112091834 TGCCTTCAGAAAGTGCAGGAAGG - Intronic
1030910444 7:115242007-115242029 CTCTTTCAGAAAATAGAGACAGG - Intergenic
1031107526 7:117563505-117563527 TTCTTCAAGAAATTAGAAGAGGG + Intronic
1031344909 7:120652950-120652972 ATCTTTTAGAATGTTGAGGATGG + Intronic
1031346403 7:120672210-120672232 TTCTGTCAGGAAGAAAAGGAAGG - Intronic
1031686886 7:124741396-124741418 TTCTTTCAGAAAATCAAGAAAGG + Intergenic
1031892586 7:127311908-127311930 TTATTTCAAAAAATAGAGGAGGG + Intergenic
1032060640 7:128722142-128722164 TTCTTTCAGAAAATAGAGGAGGG - Intronic
1032276607 7:130462023-130462045 TTGTTTCAGAAAACAGAGGTGGG - Intergenic
1032380559 7:131475451-131475473 GACTCTCAGAAATTAGAGGAAGG + Intronic
1032409066 7:131680407-131680429 TTCTTTCATAAAGTGGGAGAAGG + Intergenic
1032926289 7:136608938-136608960 GTCTTTCAGAACGTAGAGGGTGG + Intergenic
1034083178 7:148299376-148299398 TTGCATCAGAAACTAGAGGAGGG + Intronic
1034311272 7:150090986-150091008 TCCTTTCAGAAGGGAAAGGATGG - Intergenic
1034795584 7:154009657-154009679 TTCTTTCAGAAGGGAAAGGATGG + Intronic
1034828697 7:154290369-154290391 TTTTTTCAGAGCGTAGAAGATGG - Intronic
1035353007 7:158259521-158259543 TTCCTTGGGAAATTAGAGGAGGG + Intronic
1035558616 8:588071-588093 TTCTTTAAGAATGTTGAGGCCGG + Intergenic
1035585460 8:769537-769559 ATCTTTCAGAAAGTTTGGGAAGG + Intergenic
1035988446 8:4460877-4460899 TTCTTTCCAAAAATAGAAGAGGG + Intronic
1036991058 8:13594487-13594509 TTCTCTCAGAATGCAGAGGAAGG - Intergenic
1037377041 8:18241993-18242015 TTCTCTGCCAAAGTAGAGGAAGG + Intergenic
1037476648 8:19264270-19264292 TTATTTCAGAAAGTAGATTGTGG + Intergenic
1037557471 8:20039606-20039628 TTCTTTAAGAATGTTGAGTATGG + Intergenic
1037701898 8:21283035-21283057 TTCTGGAAGAAAATAGAGGAGGG + Intergenic
1038601116 8:28943542-28943564 TGCTTTCAGGAAGGAAAGGAAGG + Intronic
1039307985 8:36284659-36284681 TTGTTTCAGATCTTAGAGGAAGG + Intergenic
1039497475 8:37991792-37991814 CTTTTCCAGAAAATAGAGGAGGG - Intergenic
1039841068 8:41293536-41293558 TTAATGGAGAAAGTAGAGGAGGG - Intronic
1040082336 8:43299654-43299676 TTCTTTCAATAAGTAGAGGCTGG + Intergenic
1040611783 8:48991940-48991962 CTCTTGCAGAAAATAGAGGAGGG - Intergenic
1040926912 8:52694279-52694301 GGCTTTCAGGAAGAAGAGGAGGG + Intronic
1041837285 8:62230716-62230738 TTACTTCAGTAAGTAGAGAATGG - Intergenic
1041966084 8:63678713-63678735 CTCTTTCAGAAAATAGAAAAAGG - Intergenic
1042437518 8:68784469-68784491 TTCTTTCAAATAGTTCAGGAGGG - Intronic
1042674806 8:71308068-71308090 TTCATTCAAAAAGTAGAGGATGG + Intronic
1043543530 8:81289759-81289781 TTCTCCAAGACAGTAGAGGATGG - Intergenic
1044645311 8:94436258-94436280 TACTTTTAGAAACTACAGGAGGG + Intronic
1044797947 8:95923149-95923171 TTTTTAAAAAAAGTAGAGGAGGG + Intergenic
1045295991 8:100872096-100872118 TTCCTGCAGAAAGGAGAGCAGGG + Intergenic
1045944343 8:107778770-107778792 TTCACTCAGGAAGAAGAGGACGG + Intergenic
1046217315 8:111165011-111165033 TTCTTTGAGCAAGTAGGGCATGG - Intergenic
1047188346 8:122655783-122655805 TTCCTCCAGACAGTGGAGGAAGG + Intergenic
1047627559 8:126671967-126671989 AGCTTTCAGAAGGAAGAGGAAGG - Intergenic
1047711223 8:127554303-127554325 TTCTCTTAGACAGTAGTGGAAGG - Intergenic
1047810217 8:128400585-128400607 TTCAGTCAGAAAGTTGGGGAAGG + Intergenic
1048238811 8:132720227-132720249 TTCTTCCAGGGAGTAGAGTAAGG - Intronic
1049049093 8:140178656-140178678 TTCTTTCAGAAAGTAGAGGAGGG - Intronic
1049609411 8:143546927-143546949 TTTATTAAGAAAGTAAAGGAAGG + Intergenic
1049886956 9:34138-34160 TTCTATGAGAAAGAAGGGGAGGG + Intergenic
1050497716 9:6262313-6262335 TTCTTTAAGAATGTTGAGGCCGG + Intergenic
1050740315 9:8812177-8812199 TTCTTTAAAAAAGTGAAGGAAGG + Intronic
1050744974 9:8865406-8865428 ATATTTCAGAAAGTAAAGGAAGG + Intronic
1051294142 9:15576932-15576954 TTCTTTCAGCAAGGAAAGGCTGG + Intronic
1051354115 9:16225171-16225193 TTCTTTAAGAATGTTGAGTAGGG - Intronic
1051499310 9:17759479-17759501 TGCTTTCAAGAAGTATAGGATGG + Intronic
1051803805 9:20967995-20968017 TTCTTTCAAAAAATAGGAGAAGG - Intronic
1052012637 9:23428933-23428955 TTGATACAGAAAGTAGAGTAGGG + Intergenic
1052044543 9:23778997-23779019 TGCTATGAGAAAGAAGAGGAGGG + Intronic
1052424486 9:28286801-28286823 GCCTTTCAGAAGGTAGAGGGTGG + Intronic
1052650983 9:31300702-31300724 TTTTTCCAAAAAGTAGAGGTAGG + Intergenic
1052807647 9:33026466-33026488 TTATTTCAGGCAGTAGAAGATGG + Exonic
1053925458 9:43049906-43049928 TTCGTTGAGAAAGAAAAGGATGG - Intergenic
1054923062 9:70561057-70561079 TTTCTTCAGACAGGAGAGGAAGG - Intronic
1054933945 9:70666852-70666874 CTCTTCCAGAAAGTAGAGACAGG - Intronic
1054988935 9:71298577-71298599 TTTTTTTAAAAAGTAGATGATGG - Intronic
1055180083 9:73376573-73376595 TACTTTTAAAAATTAGAGGAGGG - Intergenic
1055232436 9:74082150-74082172 TTCTTTCTGATCTTAGAGGAAGG - Intergenic
1055680593 9:78711173-78711195 TTCTTTGAGAAAGTACGGGATGG + Intergenic
1056439035 9:86602132-86602154 TCATTTCAAAAAGCAGAGGAGGG + Intergenic
1057267422 9:93628270-93628292 CTTTTTCAGAAAATAGAAGAGGG - Intronic
1057284172 9:93735683-93735705 TTCTATCAGAGAGTGGAGGGTGG + Intergenic
1057572516 9:96215425-96215447 TTCTTTCATGAGGCAGAGGAGGG - Intergenic
1057831095 9:98407818-98407840 TTTGTTCACAAAGTAAAGGAAGG - Intronic
1057897540 9:98921860-98921882 TTCTCTCAGAAAGAAGATAAGGG + Intergenic
1058136432 9:101313006-101313028 GTTTTTCAGAGAGTAGAAGAGGG - Intronic
1058361065 9:104146623-104146645 ATCCTCCAGAAAATAGAGGAGGG - Intergenic
1059647972 9:116286136-116286158 TTCTTTCACTAAGTAGAGACGGG + Intronic
1059696752 9:116737013-116737035 AGCTTCCAGAAAGTAGAGGGGGG + Intronic
1060110147 9:120901144-120901166 TTCACCCAGAAAGGAGAGGAAGG + Intergenic
1060438998 9:123620736-123620758 TAGTTTCAGACAGAAGAGGAAGG - Intronic
1061745570 9:132737352-132737374 CTCTTTCAGAAAATAGAGGAAGG + Intronic
1203426769 Un_GL000195v1:47958-47980 TTTTTTCAAAAAGCAGTGGATGG + Intergenic
1203529957 Un_GL000213v1:131989-132011 GTCTTCCAATAAGTAGAGGATGG - Intergenic
1185846030 X:3439207-3439229 TTCTTTAAGAATGTTGAGGCTGG + Intergenic
1185962177 X:4556677-4556699 GCCTTTCAGAAAGTGGAGGGTGG - Intergenic
1186532716 X:10313613-10313635 TTCTTTCAGAAAGGGGAGTGTGG + Intergenic
1187261906 X:17692612-17692634 TTCTTTCAGGAATGAAAGGAAGG - Intronic
1188502202 X:30839760-30839782 CTCTTTGAGAAAATACAGGAGGG - Intronic
1188945903 X:36301497-36301519 ATCTTTTATAAAGTAAAGGAAGG + Intronic
1189139654 X:38588850-38588872 TTCTTTCAAAAAATAGAATAAGG - Intronic
1189358328 X:40328300-40328322 CTCTTTCAGAAACAAGAGGGCGG + Intergenic
1189867046 X:45341600-45341622 ACCTATCAGAAAGTGGAGGATGG + Intergenic
1190000109 X:46677752-46677774 TTCTTTCAGAAAATAGAAGAGGG - Intronic
1190146780 X:47899629-47899651 GTATTTCAGAAAATAGAGAAGGG - Intronic
1190149658 X:47934114-47934136 CTCTTCCAGAAAAAAGAGGAGGG - Intronic
1190690847 X:52911819-52911841 TTCTTTTAGACTATAGAGGAGGG + Intergenic
1190695136 X:52943973-52943995 TTCTTTTAGACTATAGAGGAGGG - Intronic
1191060341 X:56288944-56288966 TCCTTTCAGAGAGTACAGTATGG - Intergenic
1191097967 X:56694428-56694450 AGCTTTCAGAATGTAGAAGAAGG - Intergenic
1191658144 X:63622027-63622049 TTCTTTCAAACAGTACAGCATGG - Intergenic
1191689464 X:63925136-63925158 TTCTTTAAGACATTTGAGGAGGG - Intergenic
1191844920 X:65539967-65539989 TTTATTAAGAAAGTAAAGGAAGG - Intergenic
1191855598 X:65623458-65623480 CTCTTTCAAAAAATAGAAGAAGG - Intronic
1193044815 X:77041153-77041175 CTCTTTCATAAAATTGAGGAGGG + Intergenic
1194080794 X:89462586-89462608 TTATTTCTGAAAGTAGACTATGG + Intergenic
1194097435 X:89659275-89659297 TACTTTAAGAAAGTAGAACAGGG - Intergenic
1194375263 X:93124760-93124782 TTCATACAGAAAGTAGAAAATGG - Intergenic
1195251023 X:103047444-103047466 TTATTCCAAAAAATAGAGGAGGG - Intergenic
1195784966 X:108509270-108509292 GTCTTTCAGAGAGTGGAGGGTGG + Intronic
1195896015 X:109747023-109747045 TGCTTTCAAAGAGTAGAGTATGG + Intergenic
1196015271 X:110933224-110933246 TTCCTACAAAAAGAAGAGGAAGG + Intergenic
1196984116 X:121249346-121249368 TTATTCCAAAAAATAGAGGAGGG - Intergenic
1197162730 X:123342255-123342277 TTCTTTCAGGAAATAGAGTGGGG - Intronic
1197677854 X:129349313-129349335 TTCAATCAGAAAGAAAAGGACGG + Intergenic
1198411898 X:136379023-136379045 CTCTTTCTGAAAGTAGAAGAGGG - Intronic
1198786436 X:140293496-140293518 TTCTTTCAGAAAATAGAAGAGGG - Intergenic
1198855931 X:141016567-141016589 TTCAATCAGAAAGAAAAGGACGG - Intergenic
1198876200 X:141229544-141229566 TTCAATCAGAAAGAAAAGGATGG + Intergenic
1198890304 X:141387351-141387373 TTCTATAGGAAGGTAGAGGAAGG - Intergenic
1198906762 X:141570800-141570822 TTCAATCAGAAAGAAAAGGACGG + Intergenic
1200433471 Y:3118791-3118813 TTATTTCTGAAAGTAGACTATGG + Intergenic
1200450452 Y:3320647-3320669 TACTTTAAGAAAGTAGAACAGGG - Intergenic
1201184199 Y:11382818-11382840 TTATTTCAAATATTAGAGGATGG - Intergenic