ID: 1049049984

View in Genome Browser
Species Human (GRCh38)
Location 8:140187111-140187133
Sequence GTCAAACCTATGTAGTTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 637
Summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 568}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049049984_1049049992 22 Left 1049049984 8:140187111-140187133 CCCTCGAACTACATAGGTTTGAC 0: 1
1: 0
2: 3
3: 65
4: 568
Right 1049049992 8:140187156-140187178 GGGTTTTCTCAGCCAGACGTGGG No data
1049049984_1049049993 25 Left 1049049984 8:140187111-140187133 CCCTCGAACTACATAGGTTTGAC 0: 1
1: 0
2: 3
3: 65
4: 568
Right 1049049993 8:140187159-140187181 TTTTCTCAGCCAGACGTGGGTGG No data
1049049984_1049049989 2 Left 1049049984 8:140187111-140187133 CCCTCGAACTACATAGGTTTGAC 0: 1
1: 0
2: 3
3: 65
4: 568
Right 1049049989 8:140187136-140187158 GTGCAGGTCCACTCATATGCGGG No data
1049049984_1049049988 1 Left 1049049984 8:140187111-140187133 CCCTCGAACTACATAGGTTTGAC 0: 1
1: 0
2: 3
3: 65
4: 568
Right 1049049988 8:140187135-140187157 TGTGCAGGTCCACTCATATGCGG No data
1049049984_1049049991 21 Left 1049049984 8:140187111-140187133 CCCTCGAACTACATAGGTTTGAC 0: 1
1: 0
2: 3
3: 65
4: 568
Right 1049049991 8:140187155-140187177 CGGGTTTTCTCAGCCAGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049049984 Original CRISPR GTCAAACCTATGTAGTTCGA GGG (reversed) Intronic
900912184 1:5606308-5606330 CTCAAACCCATGTTGTTTGAGGG + Intergenic
902108039 1:14054199-14054221 TTCAAACTTATGTTGTTCTAAGG + Intergenic
903410488 1:23139395-23139417 TTCAAACCCATGTTGTTCAAGGG - Intronic
904087680 1:27921213-27921235 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
906229056 1:44145236-44145258 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
906452964 1:45967762-45967784 TTCAAACCTGTGTTGTTCAAAGG + Intronic
907020555 1:51062450-51062472 CTCAAACCCATGTTGTTCAAGGG + Intergenic
907643430 1:56215879-56215901 TTCAAACCCATGTTGTTCAAGGG + Intergenic
908371689 1:63487298-63487320 TTCAAACCCATGTTGTTCAAGGG + Intronic
908963056 1:69725341-69725363 TTCAAACCTGTGTTGTTCAAGGG + Intronic
909218207 1:72919657-72919679 CTCAAACCTGTGTTGTTCAATGG - Intergenic
909320092 1:74274376-74274398 TTCAAACCTGTGTTGTTCAAGGG + Intronic
909327807 1:74374195-74374217 GTGAAACCTATGGATTTAGAGGG + Intronic
909854559 1:80512024-80512046 TTCAAACCCATGTTGTTCTAAGG - Intergenic
910052712 1:82994508-82994530 TTCAAACCTATGTTGCTCAAGGG + Intergenic
910274790 1:85437339-85437361 TTCAAACCCATGTTGTTCAAGGG - Intronic
910412211 1:86958526-86958548 TTCAAACCCATGTTGTTCAAGGG + Intronic
910457896 1:87417432-87417454 TTCAAACCCATGTTGTTCAAGGG + Intergenic
910484285 1:87695337-87695359 TTCAAACCCATGTTGTTCAAGGG - Intergenic
911266309 1:95748621-95748643 TTCAAACCCATGTTGTTCAAAGG - Intergenic
911590567 1:99743323-99743345 TTCAAACCTGTGTTGTTCAAGGG - Intronic
911722030 1:101201909-101201931 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
911812754 1:102304526-102304548 TTCAAACCCATGTTGTTCAAGGG - Intergenic
912279144 1:108294925-108294947 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
912289082 1:108399432-108399454 TTCAAACCTGTGTTGTTCAAGGG - Intronic
912500451 1:110118573-110118595 TTCAAACCCATGTTGTTCAAGGG + Intergenic
912840831 1:113037743-113037765 TTCAAACCCATGTTGTTCAAGGG - Intergenic
912859560 1:113201204-113201226 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
913206848 1:116546799-116546821 CTCAAACCCATGTTGTTCAAGGG - Intronic
913296365 1:117324593-117324615 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
914315162 1:146503909-146503931 TTCAAACCCATGTTGTTCAAGGG + Intergenic
914499192 1:148229467-148229489 TTCAAACCCATGTTGTTCAAGGG - Intergenic
915067324 1:153236281-153236303 TTCAAACCGATGTTGTTCAAGGG + Intergenic
916784542 1:168076389-168076411 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
917071342 1:171154629-171154651 TTCAAACCTGTGTTGTTCAAAGG - Intronic
917824478 1:178803006-178803028 TTCAAACCCATGTTGTTCAAGGG + Intronic
917984909 1:180306324-180306346 TTCACACCTATGTTGTTCAAGGG + Intronic
918170519 1:181992441-181992463 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
918271871 1:182909533-182909555 TTCAAACCCATGTTGTTCAAGGG - Intronic
918910138 1:190556894-190556916 GTCATACCTGTGTAGTTTGGAGG - Intergenic
919422964 1:197394036-197394058 TTCAAACCCATGTTGTTCTAGGG - Intronic
919458989 1:197854505-197854527 TTCAAACCCATGTTGTTCAAGGG + Intergenic
920788719 1:209067722-209067744 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
921148173 1:212378757-212378779 TTCAAACCTGTGTTGTTCAAGGG - Intronic
921155627 1:212436131-212436153 TTCAAACCTGTGTTGTTCAAGGG + Intronic
921387346 1:214583640-214583662 TTCAAACCCATGTTGTTCAAGGG - Intergenic
921484115 1:215696360-215696382 TTCAAACCTGTGTTGTTCAAGGG + Intronic
921539995 1:216402405-216402427 TTCAAACCTGTGTTGTTCAAAGG - Intronic
921597957 1:217075173-217075195 TTCAAACCCATGTTGTTCGAGGG + Intronic
922773548 1:228203926-228203948 TGCAAACCTATGTTGTTCAAGGG - Exonic
923053476 1:230405243-230405265 GTCAAACCCGTGTTGTTCAAGGG - Intronic
923195712 1:231664768-231664790 TTCAAACCTGTGTCGTTCGAGGG - Intronic
923330465 1:232918872-232918894 TTCAAACCCATGTTGTTCAAGGG + Intergenic
923424594 1:233856173-233856195 CTCAAACCCATGTTGTTCAAGGG - Intergenic
923474838 1:234322620-234322642 TTCAAACCCATGTTGTTCAAGGG + Intronic
923507939 1:234622612-234622634 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
924029744 1:239874337-239874359 TTCAAACCTGTGTTGTTCGAGGG - Intronic
924143561 1:241050582-241050604 TTCAAACCCATGTGGTTCAAGGG - Intronic
1063195468 10:3737650-3737672 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1063832343 10:9968086-9968108 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1064700182 10:18010787-18010809 TTCAAACCCATGTTGTTCTAGGG - Intronic
1065506352 10:26433763-26433785 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1065572504 10:27085709-27085731 TTCAAACCTATATTGTTCAAGGG - Intronic
1065794209 10:29291456-29291478 TTCAAACCCATGTTGTTCAAGGG + Intronic
1066011564 10:31199056-31199078 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1066129759 10:32381451-32381473 CTCAAACCTGTGTTGTTCAAGGG + Intergenic
1066627504 10:37422546-37422568 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1066648781 10:37636589-37636611 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1067031674 10:42882287-42882309 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1067169054 10:43890955-43890977 TTCAAACCTATTTTGTTCAAGGG - Intergenic
1067506785 10:46860586-46860608 TTCAAACCTATATGGTTCAAAGG + Intergenic
1068393517 10:56430060-56430082 TTCAAACCTATGTTGTTCAAAGG - Intergenic
1069074478 10:64024005-64024027 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1069185062 10:65412001-65412023 GTCAAACTCATGTTGTTCAAAGG + Intergenic
1069243699 10:66174539-66174561 TTCAAACCCATGTTGTTCAAGGG - Intronic
1069677889 10:70261510-70261532 TTCAAACCCATGTTGTTCAAGGG + Intronic
1070399702 10:76042489-76042511 GTGAAACCTCTGTAATTTGAGGG + Intronic
1070858940 10:79633278-79633300 TTCAAACCTATATTGTTCAAAGG + Intergenic
1071174052 10:82902747-82902769 TTCAAACCCATGTTGTTCAAGGG - Intronic
1072109458 10:92304873-92304895 ATTAAACCTATGTAGTTAGCAGG + Intronic
1072171449 10:92866067-92866089 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1073078863 10:100843951-100843973 TTCAAACCTATGTTGTTCAAGGG - Intergenic
1074179041 10:111041122-111041144 TTCAAACCCATGTGGTTCAAGGG + Intergenic
1074593219 10:114834804-114834826 TTCAAACCCATGTTGTTCAAGGG - Intronic
1074676477 10:115856908-115856930 TTCAAACCCATGTTGTTCAAGGG - Intronic
1074991152 10:118709282-118709304 GTCAAACCCGTGTTGTTCAAGGG + Intronic
1075218330 10:120559572-120559594 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1075288376 10:121206757-121206779 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1075749483 10:124753676-124753698 TTCAAACCCATGTTGTTCAAGGG - Intronic
1075833642 10:125433555-125433577 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1077699719 11:4430375-4430397 TTCAAACCCATGTCGTTCAAAGG - Intergenic
1078434409 11:11312594-11312616 TTCAAACCCATGTTGTTCAAGGG + Intronic
1078906123 11:15689489-15689511 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1079227843 11:18623225-18623247 TTCAAACCTATGTTGTTGAAGGG + Intronic
1079540915 11:21573633-21573655 GTCAAAATTATGTAGTTCAAAGG - Intronic
1080272481 11:30465725-30465747 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1080591735 11:33729897-33729919 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1081362978 11:42202758-42202780 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1081479772 11:43475100-43475122 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1081922070 11:46787805-46787827 TTCAAACCCATGTTGTTCAAGGG - Intronic
1082274038 11:50202064-50202086 GTCATGCCTATGTTGTTCAAGGG + Intergenic
1082730922 11:56796517-56796539 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1082954357 11:58853239-58853261 TTCACACCTATGTTGTTCAAGGG - Intronic
1084702039 11:70793163-70793185 TTCAAACCCATGTTGTTCAAGGG - Intronic
1085872084 11:80362462-80362484 TTCAAACCCGTGTTGTTCGAGGG + Intergenic
1086078896 11:82882253-82882275 TTCAAACCCATGTTGTTCTAGGG + Intronic
1086266309 11:85002677-85002699 GTCAAATCCATGTTGTTCAAGGG - Intronic
1087252420 11:95917871-95917893 TTCACACCCATGTGGTTCGAGGG + Intronic
1087344631 11:96955913-96955935 TTCAAACCTATGTTGTTCAGGGG + Intergenic
1087417919 11:97882430-97882452 TTTAAACCTATGTTGTTCAAGGG - Intergenic
1087785923 11:102354103-102354125 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1087939377 11:104076705-104076727 TTCAAACCTATGTTGTTCAAGGG - Intronic
1088586453 11:111363996-111364018 GTCAAGCCAATGGAGTTTGAGGG + Intronic
1090289183 11:125527058-125527080 GTCAAACCTTTGTAGGGAGAGGG + Intergenic
1090685503 11:129113685-129113707 TTCAAACCCATGTTGTTCAAGGG + Intronic
1092812081 12:12280934-12280956 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1093116635 12:15220315-15220337 ATCATACCTATTTAGTTTGAAGG + Intronic
1093204297 12:16228554-16228576 TTCAAACCCATGTTGTTCAAGGG - Intronic
1093805253 12:23424353-23424375 TTCAAACCTATGTTGTTCAAGGG - Intergenic
1095253431 12:40005027-40005049 TTCAAACCCATGTTGTTGGAGGG + Intronic
1095471739 12:42544144-42544166 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1095610410 12:44121326-44121348 TTCAAACCCATGTTGTTCAATGG - Intronic
1095769049 12:45930958-45930980 TTAAAACCTATGTTGTTCAAGGG + Intronic
1096568765 12:52505676-52505698 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1096899561 12:54861277-54861299 TTCAAACCTGTGTTGTTCCAGGG + Intergenic
1098061052 12:66563089-66563111 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1098353738 12:69590067-69590089 TTCAAACCCATGTTGTTCAATGG - Intronic
1098542544 12:71673397-71673419 TTCAAACCTATGTTGTTAAAGGG + Intronic
1098869386 12:75800217-75800239 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1098876081 12:75867621-75867643 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1098986050 12:77013578-77013600 TTCAAACCCATGTTGTTCTAGGG - Intergenic
1099460392 12:82914010-82914032 TTCAAACCTATGTTGTTCAAGGG + Intronic
1099730794 12:86498277-86498299 TTCAAACCTCTGTTGTTCAAGGG - Intronic
1099890407 12:88582710-88582732 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1101009259 12:100432027-100432049 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1101076765 12:101138081-101138103 TTCAAACCTGTGTTGTTCCAAGG - Intergenic
1102220268 12:111189382-111189404 ATCAAGCCTGTGTAGTTCGGAGG - Intronic
1102938019 12:116913746-116913768 TTCAAACCCATGTTGTTCAAGGG + Intronic
1104135019 12:125929414-125929436 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1104184403 12:126415870-126415892 GTCAAACCCATGTTGTTCAAGGG - Intergenic
1104270186 12:127276529-127276551 TTCAGACCCATGTAGTTCAATGG - Intergenic
1104826995 12:131718977-131718999 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1104982228 12:132578533-132578555 TTCAAACCCATGTTGTTCAAGGG + Intronic
1106625451 13:31416551-31416573 TTCAAACCTGTGTTGTTCCAAGG - Intergenic
1106879596 13:34114800-34114822 GTCAAGCCTAGGTATTTCCAGGG - Intergenic
1107539182 13:41370143-41370165 TTCAAACCTATGTTGTTCAAAGG - Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1107778234 13:43871128-43871150 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1107897556 13:44981193-44981215 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1108442134 13:50465534-50465556 TTCAAAACTATATAGTTCTATGG + Intronic
1108467382 13:50730281-50730303 CTCAAACCCATGTTGTTCAAGGG + Intronic
1108961079 13:56230452-56230474 GTCAAACCCATGTTGTTCAAGGG + Intergenic
1109048306 13:57441567-57441589 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1109338160 13:61019173-61019195 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1110442521 13:75541184-75541206 TTCAAACCCATGTTGTTCAAGGG + Intronic
1111449463 13:88394900-88394922 ATCAAACCTAAGTAGTGTGAGGG + Intergenic
1111633140 13:90868915-90868937 ATCAAACCCATGTTGTTCAAGGG + Intergenic
1111771933 13:92607823-92607845 TTCAAACCCATGTTGTTCAAGGG - Intronic
1112160430 13:96861279-96861301 TTCAAACCCATGTTGCTCGAGGG - Intergenic
1112232119 13:97599582-97599604 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1112301681 13:98236464-98236486 TTCAAACCTGTGTTGTTCAATGG - Intronic
1112400666 13:99075320-99075342 TTCAAACCCATGTTGTTCAAAGG + Intronic
1113012503 13:105786122-105786144 TTCAAACCCATGTAGTTCAAGGG + Intergenic
1113163874 13:107415959-107415981 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1113235900 13:108273846-108273868 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1113271882 13:108683604-108683626 GTCAAATCTATGTTGTCCCAGGG - Intronic
1114384605 14:22242260-22242282 CTCAAACCTATGCCGCTCGAGGG + Intergenic
1114775032 14:25472300-25472322 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1115303098 14:31906329-31906351 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1116447157 14:45023218-45023240 CTCAAACCTATGCCGCTCGAGGG - Intronic
1116564118 14:46423224-46423246 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1116698736 14:48209609-48209631 ATCAAACCTGTGTTGTTCAAGGG + Intergenic
1117102767 14:52367400-52367422 GTCAAACTTGTGTAGTACAAAGG + Intergenic
1117422660 14:55562208-55562230 TTCAAACCCATGTTGTTCGAGGG + Intronic
1117425601 14:55592448-55592470 TTCAAACCCATGTTGTTCAAGGG - Intronic
1117608171 14:57453567-57453589 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1117683902 14:58233337-58233359 TTCAAACCCATGTTGTTCAAGGG - Intronic
1118168944 14:63366293-63366315 TTCAAACCCATGTTGTTCAATGG - Intergenic
1118388184 14:65274164-65274186 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1119070599 14:71579404-71579426 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1120581845 14:86261398-86261420 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1121393025 14:93592612-93592634 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1122185541 14:99990960-99990982 TTCAAACCCATGTTGTTCAAGGG - Intronic
1123454311 15:20405405-20405427 CTCAAACCTATGTTGTTAAAGGG - Intergenic
1124095086 15:26641822-26641844 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1124437213 15:29660764-29660786 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1124506435 15:30279858-30279880 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1124639596 15:31389021-31389043 TTCAAACCCATGTTGTTCAATGG - Intronic
1124704184 15:31947907-31947929 TTCAAACCCATGTCGTTCAAGGG - Intergenic
1124737122 15:32258778-32258800 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1125086384 15:35735029-35735051 ATCAAACCTATGTTGTTCAAGGG - Intergenic
1125160283 15:36635335-36635357 TTCAAACCCATGTTGTTCAAGGG - Intronic
1125311488 15:38383617-38383639 CTCAAACCCATGTTGTTCAAGGG - Intergenic
1126129307 15:45325054-45325076 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1126342362 15:47655066-47655088 TTCAAACCCATGTTGTTCAAAGG + Intronic
1127101876 15:55574615-55574637 TTCAAACCCATGTTGTTCAAAGG + Intronic
1127607189 15:60598342-60598364 GTCAAATCTGTGTTGTTCAAGGG - Intronic
1127658955 15:61082126-61082148 GTCAAACCTATGTCATTTAAGGG - Intronic
1127747826 15:61998746-61998768 TTCAAACCCATGTTGTTCAAGGG - Intronic
1129625812 15:77197798-77197820 TTCAAACCCATGTTGTTCAAGGG - Intronic
1131077785 15:89506817-89506839 CTCAAACCTATGTTGTTAAAGGG - Intergenic
1131409337 15:92193297-92193319 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1131575213 15:93582656-93582678 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
1131728736 15:95256301-95256323 TTCAAACCTGTGTTGTTCGAGGG + Intergenic
1132192603 15:99880768-99880790 TTCAAACCCATGCTGTTCGAGGG + Intergenic
1133628390 16:7593619-7593641 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1134139638 16:11706856-11706878 TTCAAACCCATGTTGTTCAAGGG - Intronic
1134331242 16:13252874-13252896 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1138237291 16:55395233-55395255 TTCAAACCTGTGTTGTTCAATGG - Intronic
1138609753 16:58113421-58113443 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1138759434 16:59523386-59523408 TTCAAACCCATGTTGTTCGAGGG + Intergenic
1138944252 16:61828655-61828677 GTTAAACCTGTGTTGTTCAAGGG + Intronic
1139321646 16:66119121-66119143 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1140553175 16:75890107-75890129 TTCAAACCTATGTTGTTCAAGGG - Intergenic
1141310471 16:82908825-82908847 TTCAAACCCATGTAGTTCAAGGG - Intronic
1142067264 16:88069798-88069820 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1143677756 17:8448718-8448740 TTCAAACCCATGTTGTTCAAGGG - Intronic
1143754954 17:9060097-9060119 TTCAAGCCTGTGTTGTTCGAGGG - Intronic
1143762052 17:9111928-9111950 TTCAAACCCATGTTGTTCAATGG + Intronic
1144096937 17:11908245-11908267 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1145024366 17:19456751-19456773 TTCAAACCTGTGTTGTTCGAGGG - Intergenic
1145394318 17:22482662-22482684 TTCAAACCTCTGTTGTTCAAAGG + Intergenic
1145857623 17:28177250-28177272 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1146246812 17:31292607-31292629 TTCAAACCCATGTTGTTCAAGGG + Intronic
1146754644 17:35418291-35418313 TTCAAACCCATGTTGTTCAAGGG - Intronic
1147330027 17:39693139-39693161 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1148384911 17:47227435-47227457 TTCAAGCCTATGTTGTTCAAGGG - Intergenic
1149068356 17:52507646-52507668 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1149165756 17:53750046-53750068 TTCAAACCCATGTTGTTCAAAGG - Intergenic
1149944942 17:60914581-60914603 TTCAAACCCATGTTGTTCAATGG - Intronic
1150241233 17:63634649-63634671 GTCAAACTTATGTTGCACGAAGG + Intronic
1150261732 17:63798509-63798531 TTCAAACCTGTGTTGTTCAAAGG - Intronic
1150512323 17:65768417-65768439 TTCAAACCTGTGTCGTTCAAGGG + Intronic
1151860850 17:76760462-76760484 TTCAAACCCATGTTGTTCAAGGG + Intronic
1152007630 17:77692527-77692549 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1153319139 18:3754351-3754373 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1153369525 18:4298297-4298319 GTCAAACCCATGTTGTTCAAGGG + Intronic
1153499706 18:5735893-5735915 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1153794104 18:8607167-8607189 TTCAAACCCATGTTGTTCTAGGG + Intergenic
1154984682 18:21537866-21537888 TTCAAACTTTTGTTGTTCGAGGG - Intronic
1156216847 18:35007776-35007798 TTCAAACCCATGTTGTTCAAGGG - Intronic
1156323522 18:36051102-36051124 GTCAGACCTATGTTGTTCAATGG + Intronic
1157904118 18:51552173-51552195 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1157928628 18:51794215-51794237 CTCAAACCTATGTTATTCAAGGG - Intergenic
1158129424 18:54136400-54136422 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1158731172 18:60024038-60024060 TTCAAACCTATGCTGTTCAAGGG - Intergenic
1159457638 18:68681419-68681441 TTCAAACTTATGTTGTTCAACGG + Intronic
1160483374 18:79263474-79263496 TTCAAACCTGTGTTGTTTGAGGG + Intronic
1162429005 19:10615705-10615727 CTCAAACCTGTGTTGTTGGAAGG + Intronic
1163163890 19:15482184-15482206 GTCAAACCCATGTTGTTCAAGGG - Intronic
1163286542 19:16351957-16351979 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1164922387 19:32098435-32098457 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1165615508 19:37196477-37196499 TTCAAACCCATGTGGTTCAAAGG - Intronic
1166607290 19:44155594-44155616 GTCAAACCTGTGTTGTTCAACGG + Intronic
1168503591 19:56914274-56914296 TTCAAACCTGTGTTGTTTGAGGG + Intergenic
925007968 2:459670-459692 GTCAAACCCGTGTTGTTCAAGGG + Intergenic
925263620 2:2548922-2548944 GTCAAACCTGTGTTGTTCAAGGG + Intergenic
925439364 2:3870635-3870657 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
926019381 2:9481966-9481988 TTCAAACCTGTGTTGTTCAAGGG + Intronic
926282659 2:11463166-11463188 TTCAAACCTGTGTTGTTTGAGGG - Intronic
926350883 2:11993328-11993350 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
927370921 2:22354445-22354467 TTCAAACCCATGTTGTTCAAGGG - Intergenic
927397031 2:22664479-22664501 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
927524641 2:23726615-23726637 TTCAAACCCATGTTGTTCAAGGG + Intergenic
928014046 2:27637406-27637428 TTCAAACCTATGTTGTTTAAGGG + Intronic
928192166 2:29181371-29181393 TTCAAACCTGTGTAGTTCATGGG + Intronic
928568135 2:32574726-32574748 TTCAAACCTGTGTTGTTCAAGGG + Intronic
928822714 2:35381342-35381364 TTCAAACCCATGTTGTTCAAGGG + Intergenic
929094800 2:38253167-38253189 TTCAAACCCATGTTGTTCAAGGG + Intergenic
929474068 2:42227596-42227618 TTCAAACCTGTGTTGTTCAAGGG - Intronic
929727752 2:44448310-44448332 TTCAAACCTGTGTTGTTCAAGGG + Intronic
929845636 2:45522581-45522603 TTCAAACCCATGTTGTTCAAGGG - Intronic
930325404 2:49910447-49910469 GTCAATCCCATGTAGTTCAAGGG + Intergenic
930609937 2:53530889-53530911 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
930945693 2:57072233-57072255 TTCAAACCTATGTTGTTCAAGGG - Intergenic
931029935 2:58162450-58162472 TTCAAACCCATGTTGTTCAAGGG - Intronic
931162402 2:59706264-59706286 TTCAAACCCATGTTGTTCAAGGG - Intergenic
931225863 2:60330867-60330889 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
931627444 2:64269744-64269766 TGCAAACCCATGTAGTTCAAGGG - Intergenic
932864095 2:75323577-75323599 TTCAAACCCATGTTGTTCAAGGG - Intergenic
932955010 2:76341432-76341454 TTCAAACCCATGTTGTTCAAGGG + Intergenic
932996233 2:76857059-76857081 TTCAAACCTATGTTGTTCAAGGG - Intronic
933337847 2:80982861-80982883 GTCAAACTTCTGTTGTTCAAGGG + Intergenic
933439210 2:82289005-82289027 TTCAAACCCATGTTGTTTGAGGG - Intergenic
933830683 2:86205535-86205557 TTCAAACCCATGTTGTTCAAGGG + Intronic
934719506 2:96563740-96563762 TTCAAACCCATGTTGTTCAAGGG + Intergenic
934944068 2:98523859-98523881 GTCAAACATATATATTTGGAAGG - Intronic
935198927 2:100838911-100838933 TTCAAACCTCTGTTGTTCAAGGG - Intronic
937088485 2:119188684-119188706 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
937151306 2:119687953-119687975 TTCAAACCTATGTATTTCCTAGG + Intergenic
937766836 2:125671255-125671277 TTCAAATCTATGTTGTTCAAGGG - Intergenic
937777613 2:125798413-125798435 TTCAAACCCATGTTGTTCAAGGG + Intergenic
938148122 2:128855090-128855112 TTCAAACCCATGTTTTTCGAGGG + Intergenic
939081578 2:137668981-137669003 TTCAAACCTGTGTTGTTCAAGGG + Intronic
939223319 2:139332545-139332567 TTCAAACCCATGTTGTTCAAAGG + Intergenic
939719848 2:145634956-145634978 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
939723502 2:145684747-145684769 TTCAAACCCATGTTGTTCAAGGG - Intergenic
939749565 2:146026449-146026471 TTCAAACCCATGTTGTTCAAGGG - Intergenic
939814095 2:146872533-146872555 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
940017987 2:149126658-149126680 TTCAAACCTGTGTCGTTCAAGGG + Intronic
940875978 2:158897554-158897576 TTCAAACCTATGTTGTTCAAGGG - Intergenic
941128800 2:161620802-161620824 CTCAAACCTCTGTTGTTCAAGGG - Intronic
941280806 2:163548395-163548417 TTCAAACCAATGTTGTTCAAGGG - Intergenic
942009336 2:171743379-171743401 TTCAAACCTATATGGTTCAAGGG + Intronic
942146932 2:173035998-173036020 TTCAAACCTGTGTTGTTCAAAGG + Intronic
942245784 2:174006509-174006531 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
942478983 2:176361952-176361974 TTCAAACCCATGTTGTTCGAGGG + Intergenic
942991120 2:182204392-182204414 TTCAAACTTATGTTGTTCAAGGG - Intronic
944247597 2:197547260-197547282 TTCAAACCTGTGTTGTTCAAGGG + Intronic
944658897 2:201903847-201903869 TTCAAACCCATGTTGTTCAAGGG + Intergenic
945643917 2:212466215-212466237 TTCAAACCTGTGTTGTTCAAGGG - Intronic
945796942 2:214376867-214376889 TTCAAACCTGTGTTGTTCCAGGG - Intronic
946677936 2:222182217-222182239 TTCAAACCCATGTTGTTCAAGGG - Intergenic
946970502 2:225085836-225085858 TTCAAACCTATGTTGTTCAAGGG - Intergenic
947605874 2:231484778-231484800 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
947762584 2:232614224-232614246 TTCAAACCTGTGTTGTTCAAGGG - Intronic
948342539 2:237266346-237266368 TTCAAACCCATGTTGTTCAAGGG - Intergenic
948451158 2:238073669-238073691 TTCAAACCCATGTTGTTCAAGGG - Intronic
1169058788 20:2645416-2645438 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1169514504 20:6301064-6301086 GTCAATCCTATGTATATCCATGG + Intergenic
1169536346 20:6546002-6546024 TCCAAACCTATGTTGTTCAAGGG + Intergenic
1169855866 20:10102173-10102195 TTCAAATCCATGTTGTTCGAGGG - Intergenic
1170227981 20:14013237-14013259 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1170440402 20:16373771-16373793 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1170602744 20:17854151-17854173 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1171418111 20:24997333-24997355 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1171445656 20:25202283-25202305 TTCAAACCCATGTTGTTTGAGGG + Intronic
1173289888 20:41705382-41705404 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1173342799 20:42168264-42168286 TTCAAACCCATGTTGTTCAAGGG + Intronic
1174839643 20:53889600-53889622 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1177910762 21:27028441-27028463 TTCAAACCTATGTTGTTCAAGGG + Intergenic
1177928334 21:27248047-27248069 GTCAACCCCATGTTGTTCAATGG - Intergenic
1178869039 21:36356456-36356478 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1179161336 21:38902056-38902078 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1182382640 22:29905353-29905375 TTCAAACCCCTGTTGTTCGAAGG + Intronic
1182404233 22:30110747-30110769 CTCAAACCCATGTTGTTCAAAGG - Intronic
949340818 3:3028811-3028833 CTCAAACCTGTGTTGTTCAAGGG - Intronic
949443731 3:4111317-4111339 TTCAAACCCATGTTGTTCAAGGG + Intronic
949522058 3:4866442-4866464 TTCAAACCCATGTTGTTCAAGGG + Intronic
949557121 3:5164191-5164213 TTCAAACCTGTGTAGTTCAAGGG + Intronic
949684807 3:6556638-6556660 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
950976665 3:17253822-17253844 TTCAAACCTGTGTTGTTCAAGGG - Intronic
950997703 3:17521212-17521234 TTCAAACCCATGTTGTTCAAGGG - Intronic
951015159 3:17723579-17723601 TTCAAACCCATGTTGTTCAAGGG - Intronic
951959168 3:28295922-28295944 CTCAAACCCATGTTGTTCAAGGG + Intronic
951965630 3:28381535-28381557 TTCAAACCTATGTTATTCAAGGG + Intronic
955152427 3:56381507-56381529 TTCAAACCCATGTAGTTCAAGGG + Intronic
955425862 3:58788986-58789008 TTCAAACCCATGTTGTTCAAGGG + Intronic
955689812 3:61579875-61579897 TTCAAACCCATGTTGTTCGAGGG - Intronic
955959625 3:64326922-64326944 TTCAAACCTGTGTTGTTCCAGGG + Intronic
956794523 3:72705654-72705676 TTCAAACCCATGTTGTTCAAGGG - Intergenic
956999982 3:74874270-74874292 CTCAAACCTATGCTGCTCGAGGG - Intergenic
958075821 3:88676903-88676925 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
958119879 3:89271818-89271840 TTCAAACCCATGTTGTTCGAGGG - Intronic
959014952 3:101123257-101123279 TTCAAACCTGTGTTGTTCAAAGG + Intergenic
959444163 3:106417137-106417159 TCCAAACCTATGTTGTTCAAGGG - Intergenic
959668446 3:108947431-108947453 TTCAAACCTGTGTTGTTCAAGGG + Intronic
959773494 3:110128003-110128025 TTCAAACCTATGTGGTTCAAAGG + Intergenic
959830853 3:110860622-110860644 CTGAAACCTATGTTGTTCGAGGG + Intergenic
960004619 3:112769332-112769354 TTCAAACCCATGTTGTTCAAGGG + Intronic
962149474 3:132877825-132877847 ATCAAATGTATGTATTTCGAGGG + Intergenic
962347923 3:134634648-134634670 TTCAAACCCATGTTGTTCAAGGG - Intronic
962523305 3:136216732-136216754 TTCAAACCCATGTTGTTCAAGGG - Intergenic
962551666 3:136499146-136499168 TTCAAACCCATGTTGTTCAAAGG + Intronic
963031612 3:140983926-140983948 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
963335315 3:143968773-143968795 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
964956444 3:162363818-162363840 TTCAAACCCATGTTGTTCAAAGG - Intergenic
965187120 3:165479181-165479203 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
965319810 3:167239346-167239368 TTCAAACCTATGTTTTTCAAGGG - Intergenic
965330951 3:167373907-167373929 TTCAAACCTATGATGTTCAAGGG + Intronic
966370954 3:179250239-179250261 TTCAAACCCATGTTGTTCAAAGG + Intronic
966760525 3:183413976-183413998 TTCAAACCTATGTTGTTCAAGGG + Intronic
966981486 3:185140196-185140218 TTCAAACCCATGTTGTTCAAGGG + Intronic
967553183 3:190823735-190823757 TTCAAACCCATGTTGTTTGAGGG + Intergenic
967720048 3:192806466-192806488 CTCAAACCTGTGTTGTTCAAGGG + Intronic
968242170 3:197100041-197100063 TTCAAACCTGTGTTGTTCAAGGG + Intronic
968344941 3:197995006-197995028 TTCCAACCTATGTTGTTCAAGGG - Intronic
970393488 4:15641289-15641311 TTCAAACCTGTGTTGTTCAAGGG - Intronic
970422358 4:15917030-15917052 TTCAAACCTGTGTAGTTCAAGGG - Intergenic
970898758 4:21134124-21134146 TTCAAACCCATGTTGTTCAAAGG - Intronic
970914332 4:21315168-21315190 CTCTAACCTATGTCGTTCAAGGG - Intronic
971796370 4:31233980-31234002 GTGAAACCTGTGTTGTTCAAGGG + Intergenic
972166866 4:36297228-36297250 TTCAAACCTATGTTGTTCAAGGG + Intronic
973133877 4:46682040-46682062 TTCAAACCTATTTTGTTCAAGGG - Intergenic
974337986 4:60576368-60576390 TTCAAACCCATGTCGTTCGAGGG - Intergenic
974506128 4:62774553-62774575 ATCAAACCTGTGTTGTTCAAAGG + Intergenic
975068376 4:70098925-70098947 TTCAAACCTATGCTGTTCAAGGG + Intergenic
975527089 4:75362713-75362735 CTCAAACCCATGTTGTTCAAGGG + Intergenic
975601979 4:76110702-76110724 TTCAAACCTGTGTTGTTCAAGGG - Intronic
975795248 4:78000237-78000259 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
975908239 4:79241056-79241078 TTCAAACCTATGTTATTCAAGGG - Intronic
976083163 4:81379064-81379086 TTCAAACCTGTGTCGTTCAAGGG + Intergenic
976431780 4:84970525-84970547 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
976883845 4:89962632-89962654 TACAAACCTATGTTGTTCAAGGG + Intergenic
977232089 4:94463703-94463725 TTCAAACCTGTGTTGTTCAAGGG + Intronic
977337578 4:95718020-95718042 TTCAAACCCATGTTGTTCAAGGG - Intergenic
977552698 4:98458804-98458826 TTCAAACCCATGTTGTTCAAGGG - Intergenic
977552725 4:98459041-98459063 TTCAAACCCATGTTGTTCAAGGG + Intergenic
977878392 4:102176013-102176035 TTCAAACCCATGTTGTTCAAGGG - Intergenic
978155744 4:105488021-105488043 CTCAAACCTATGCTGCTCGAAGG + Intergenic
978566597 4:110089282-110089304 TTCAAACCTATGTTGTTTGAAGG - Intronic
978598583 4:110404599-110404621 TTCAAACCCATGTTGTTTGAAGG + Intronic
978685395 4:111436324-111436346 GTCAAACTTGTGTTGTTCAAAGG - Intergenic
978935597 4:114371316-114371338 TTCAAACCCATGTTGTTCAAAGG - Intergenic
979315889 4:119262724-119262746 TTCAAACCTGTGTTGTTCAAGGG + Intronic
980986403 4:139699665-139699687 TTCAAACCCATGTTGTTCAAGGG + Intronic
981472848 4:145156840-145156862 TTCAAACCTATGTTGTTCAAGGG - Intronic
981498724 4:145423209-145423231 CTCAAACCCATGTTGTTCAAGGG + Intergenic
981571479 4:146155947-146155969 TTCAAACCCATGTCGTTCAAGGG - Intergenic
981666630 4:147234335-147234357 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
981942156 4:150293720-150293742 TTCAAACCTATGTTGTTCAAGGG - Intronic
982411890 4:155086898-155086920 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
982473930 4:155827211-155827233 TTCAAACCCATGTTGTTCAAAGG - Intergenic
982591214 4:157314128-157314150 TTCAAACCCATGTTGTTCAAGGG + Intronic
983039520 4:162908591-162908613 TTCAAACCTCTGTTGTTCAAGGG - Intergenic
983344853 4:166515150-166515172 TTCAAACCTATGTTGCTCAAGGG + Intergenic
983640403 4:169939864-169939886 GCCAAACCTGTGTTGTTCAAGGG + Intergenic
983933768 4:173481482-173481504 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
984071956 4:175126248-175126270 TTCAAACCTGTGTTGTTCAAAGG + Intergenic
984251387 4:177339644-177339666 TTCAAACCCATGTTGTTCAAAGG + Intronic
984284884 4:177716601-177716623 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
984423805 4:179558286-179558308 TTCAAACCCATGTTGTTCAAGGG + Intergenic
984424931 4:179571352-179571374 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
984864249 4:184267756-184267778 TTCAAACCCATGTTGTTTGAGGG + Intergenic
985192014 4:187384657-187384679 TTCAAACCCATGTTGTTCAAGGG + Intergenic
985771025 5:1810893-1810915 TTCACACCTATGTTGTTCAAGGG - Intronic
986366945 5:7041948-7041970 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
986473624 5:8100887-8100909 TTCAAACCCATGTAGTTCAAGGG + Intergenic
986874815 5:12095105-12095127 TTCAAACCCATGTTGTTCAACGG - Intergenic
987789388 5:22545174-22545196 CTTAAACCAATGTAGTTCAAAGG + Intronic
987964074 5:24849894-24849916 GTTAAACCTGTGTTGTTCAAGGG + Intergenic
988118685 5:26930540-26930562 TTCAAACCCATGTTGTTCAAGGG + Intronic
988822478 5:34901286-34901308 TTCAAACCCATGTTGTTCAAGGG + Intergenic
989352668 5:40504379-40504401 TTCAAACCCATGTTGTTCAAGGG + Intergenic
989462638 5:41718358-41718380 TTCAAACCTATGTTGTTCAAGGG + Intergenic
989650078 5:43678264-43678286 CTCAAACCCATGTTGTTCAAGGG + Intronic
990363519 5:55046017-55046039 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
990467327 5:56082606-56082628 TTCAAACCTGTGTTGTTCGAGGG - Intergenic
991098380 5:62763786-62763808 TTCAAACCCATGTTGTTCAAGGG + Intergenic
991954546 5:71979846-71979868 TTCAAACCCATGTTGTTCAAGGG - Intergenic
992267948 5:75036194-75036216 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
992359739 5:76024883-76024905 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
992542939 5:77782335-77782357 TTCAAACCTATGTTGTACAAGGG + Intronic
992715226 5:79503929-79503951 TTCAAACCTGTGTTGTTCAAGGG + Intronic
992956102 5:81910027-81910049 CTTAAACCTATGTTGTTCAAGGG - Intergenic
993322213 5:86485694-86485716 GTCAAGCCTGTGTTGTTCAAGGG + Intergenic
993970404 5:94412796-94412818 TTCAAACCCATGTTGTTCAAGGG - Intronic
994004503 5:94821877-94821899 TTCAAACTTATGTTGTTTGAGGG + Intronic
994442442 5:99826960-99826982 TTCAAACCGATGTTGTTTGAGGG - Intergenic
994478352 5:100299687-100299709 TTCAAACCTATGTTGTTCAAGGG + Intergenic
994628245 5:102249140-102249162 TTCAAACCTGTGTTGTTCAAGGG - Intronic
994922273 5:106062520-106062542 TTCAAACCCATGTTGTTCAAGGG - Intergenic
994977717 5:106831458-106831480 TTCAAACCTATGTTTTTCAAGGG + Intergenic
995160698 5:108977500-108977522 TTCAAACCTATGTAGTTCAAGGG + Intronic
995217340 5:109611086-109611108 TTCAAACCCATGTTGTTCAAGGG - Intergenic
995673845 5:114639803-114639825 TTCAAACCTAAGTTGTTCAAGGG + Intergenic
996215524 5:120860721-120860743 TTCAAACCCATGTTGTTCAAGGG - Intergenic
996611040 5:125380928-125380950 TTCAAACCTATGTTGTTCAGGGG + Intergenic
996844708 5:127886395-127886417 TGCAAACCTATGTTGTTCAAGGG - Intergenic
996988525 5:129598984-129599006 TTCAAACCCATGTTGTTCAAGGG + Intronic
997119707 5:131161802-131161824 GTCAAACCCATGTTGTGCAAGGG - Intronic
997132016 5:131286551-131286573 TTCAAACCCATGTTGTTCAAGGG - Intronic
998100983 5:139434271-139434293 CTCAAACCTGTGTTGTTCAAAGG + Intronic
998510133 5:142706302-142706324 TTCAAACCCATGTTGTTCAAGGG + Intergenic
998701889 5:144712220-144712242 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
999114138 5:149147601-149147623 TTCAAACCTATGTTGTTCAAGGG + Intronic
999170870 5:149593896-149593918 GTCAAACCCATGCTGTTCAAGGG + Intronic
999244271 5:150144971-150144993 TTCAAACCTGTGTAGTTCAAGGG - Intronic
999412475 5:151364339-151364361 TTCAAACCCATGTTGTTCAAGGG + Intergenic
999775047 5:154805499-154805521 TTCAAACCCATGTTGTTCAAGGG + Intronic
1001132588 5:169077001-169077023 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1001655635 5:173347371-173347393 TTCAAACCTGTGTTGTTCAAAGG + Intergenic
1001663531 5:173413893-173413915 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1001711126 5:173779003-173779025 TTCAAACCTGTGTTGTTTGAAGG + Intergenic
1002952545 6:1829218-1829240 TTCAAACCCATGTTGTTCAAGGG + Intronic
1003105953 6:3216104-3216126 GTCAAACCCATGTTGTTTAAGGG + Intergenic
1003232528 6:4267598-4267620 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1003765507 6:9231773-9231795 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1003781962 6:9439310-9439332 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1003947106 6:11086001-11086023 TTCAAACCTATGTTGTTTGAGGG + Intergenic
1004690562 6:17988736-17988758 TTCAAACCCGTGTTGTTCGAGGG - Intergenic
1005204525 6:23386513-23386535 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1005881471 6:30065270-30065292 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1007036129 6:38675458-38675480 TTCAAACCTATGTTGTTCAAGGG + Intergenic
1007806503 6:44453914-44453936 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1008216000 6:48789524-48789546 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1008585982 6:52949875-52949897 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
1009294682 6:61931701-61931723 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1009439322 6:63657711-63657733 TTCAAACCCATGTTGTTCAAGGG + Intronic
1009729001 6:67574805-67574827 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1009834205 6:68976828-68976850 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1009958565 6:70488839-70488861 ATCAAACCTATGTTGCTCAAGGG + Intronic
1009988277 6:70808202-70808224 TTCAAACCCATGTCGTTCAAGGG + Intronic
1010340405 6:74744338-74744360 TTCAAACCCATGTTGTTTGATGG - Intergenic
1011116148 6:83894943-83894965 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1011623318 6:89263056-89263078 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1011894626 6:92210173-92210195 TTCAAACCTGTGTTATTCGAGGG - Intergenic
1012108117 6:95192015-95192037 GCCAAACCTATGAATTTCTAAGG + Intergenic
1012421270 6:99068251-99068273 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1013176931 6:107685879-107685901 GTCAAACCTAGGGAGTTACATGG - Intergenic
1013330021 6:109091126-109091148 TTCAAACCTATGCTGTTCAAGGG + Intronic
1013857106 6:114586201-114586223 TTTAAACCTATGTTGTTCAAGGG + Intergenic
1014269792 6:119324080-119324102 TTCAAACCCATGTTGTTCAAGGG - Intronic
1014311828 6:119813282-119813304 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1014645866 6:123971917-123971939 TTCAAACCCATGTTGTTCAAAGG - Intronic
1015218537 6:130777962-130777984 CTCAAACCTGTGTGGTTCAAGGG + Intergenic
1015667011 6:135642812-135642834 TTCAAACCTGTGTTGTTCAAAGG + Intergenic
1016543644 6:145195742-145195764 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1017984303 6:159429594-159429616 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1018014382 6:159698992-159699014 TTCAAACCCATGTTGTTCAAGGG + Intronic
1018066739 6:160129869-160129891 TTCAAACCCATGTTGTTCGAGGG + Intronic
1019096830 6:169588540-169588562 TTCAAACCCATGTTGTTCAAGGG + Intronic
1019208962 6:170389140-170389162 TTCAAACCCATGTTGTTCAAGGG + Intronic
1019848592 7:3531159-3531181 GCAAACCCTATGTAGTTTGAGGG - Intronic
1020123184 7:5517193-5517215 ATCAAGCCTATGAAGTTGGAGGG - Intergenic
1020398408 7:7745294-7745316 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1020425306 7:8059144-8059166 GTCAAACCCATGTTGTTCGAGGG + Intronic
1020589067 7:10111389-10111411 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1020590072 7:10124404-10124426 TTCAAACCTATGTTGTTCAAGGG + Intergenic
1020943506 7:14570858-14570880 TTCAAACCTGTGTTGTTCAAAGG + Intronic
1021089770 7:16469786-16469808 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1021164481 7:17319033-17319055 TTCAAACCCATGTTGTTCAAGGG + Intronic
1021353035 7:19618622-19618644 TTCAAACCTAAGTTGTTCAAGGG + Intergenic
1021407914 7:20295239-20295261 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1021854481 7:24840236-24840258 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1022820605 7:33956464-33956486 TTCAAACCCATGTTGTCCGAGGG - Intronic
1023375459 7:39551105-39551127 GTCAGACCCATGTAGTTCGAAGG - Intergenic
1023386203 7:39660644-39660666 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1024833861 7:53493364-53493386 TTTAAACCTATGTTGTTCAAGGG + Intergenic
1024927863 7:54636786-54636808 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1026814280 7:73497746-73497768 TTCAAACCTATGTTGTTCAAGGG + Intronic
1027591025 7:80119454-80119476 GTCAAATATGTGTAGTTTGATGG - Intergenic
1027893195 7:84004866-84004888 TTCAAACCCATGTTGTTCAAGGG - Intronic
1028030456 7:85905556-85905578 TTCAAACCTGTGTTGTTCAATGG - Intergenic
1028152777 7:87393816-87393838 TTCAAACCCATGTTGTTCAAGGG - Intronic
1028606513 7:92661821-92661843 TTCAAACCTATGTTGTTCAAGGG + Intronic
1029913891 7:104186162-104186184 TTCAAACCTATGTCGTTCAAGGG - Intronic
1029962373 7:104701669-104701691 TTCAAACCTGTGTAGTCCAATGG + Intronic
1030787500 7:113680452-113680474 TTCAAACCGATGTTGTTGGAGGG + Intergenic
1030791020 7:113729246-113729268 TTCAAACCCATGTCGTTCCAGGG - Intergenic
1030910068 7:115236310-115236332 TTCAAACCCATGTTGTTCGGTGG + Intergenic
1031549797 7:123094808-123094830 TTCAAACCTCTGTTGTTCTAAGG + Intergenic
1031963246 7:128008553-128008575 GTCCCACCTAGGGAGTTCGAGGG - Intronic
1032730254 7:134634681-134634703 CTCAAACCCATGTTGTTCTAGGG - Intergenic
1032867152 7:135937639-135937661 TTCAAACCCATGTCGTTCAAGGG - Intronic
1034238772 7:149593441-149593463 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1034242200 7:149619205-149619227 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1034878222 7:154743952-154743974 TTCAAACCTATATTGTTCAAGGG + Intronic
1038346007 8:26733217-26733239 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1038502435 8:28056505-28056527 TTCAAACCCATGTAGTCCAAGGG - Intronic
1038923825 8:32115639-32115661 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1039270691 8:35877081-35877103 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1040630356 8:49202795-49202817 TTCACACCTGTGTAGTTCAAGGG - Intergenic
1040765126 8:50900372-50900394 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1041353250 8:56971398-56971420 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1041779195 8:61558833-61558855 TTCAAACCAATGTTGTTCAAAGG - Intronic
1041867815 8:62596790-62596812 CTCAAACCTATGCTGTTCGAGGG - Intronic
1042960185 8:74295026-74295048 TTCAAACTTATGTAGGTCCAGGG - Intronic
1043736596 8:83754916-83754938 TTCAAACCTGTATAGTTCGAGGG - Intergenic
1044399994 8:91759351-91759373 TTCAAACCTGTGTTGTTCAATGG + Intergenic
1044489056 8:92790418-92790440 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1045668774 8:104523117-104523139 TTCAAACCCATGTTGTTCAAAGG - Intronic
1046414593 8:113896166-113896188 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1046765599 8:118066100-118066122 TTCAAACCTATGTTGTTCAAGGG - Intronic
1046921380 8:119732922-119732944 TTCAAACCCATGTTGTTCAAGGG - Intronic
1047113118 8:121812962-121812984 CTCAAACCAATGTTGTTCAAGGG - Intergenic
1047904862 8:129462127-129462149 TTCAAACCTGTGTTGTTCCAGGG + Intergenic
1048462374 8:134632063-134632085 TTCAAACCCATGTTGTTCAAGGG - Intronic
1049049984 8:140187111-140187133 GTCAAACCTATGTAGTTCGAGGG - Intronic
1049837043 8:144742946-144742968 TTCAAACCCATGTTGTTCAAAGG + Intronic
1050302197 9:4270947-4270969 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1050957473 9:11683008-11683030 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1050975899 9:11937718-11937740 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1051604100 9:18903887-18903909 TTCAAACCCATGTTGTTCAAAGG + Intronic
1052435415 9:28421739-28421761 ATCAAACCCATGTTGTTCAAGGG + Intronic
1052479536 9:29005808-29005830 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1054946390 9:70800471-70800493 TTCAAACCCATGTTGTTCAAGGG - Intronic
1055674549 9:78642868-78642890 GTCAAACATATGCAGTGGGATGG - Intergenic
1056024222 9:82475831-82475853 TTCAAACCTATGTTGTTTAAGGG + Intergenic
1056464677 9:86842163-86842185 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1056964464 9:91154512-91154534 TTCAAACCTATGTTGTTAAAGGG + Intergenic
1057042405 9:91857198-91857220 GTTAGACCTGTGTAGTTGGATGG - Intronic
1057059432 9:91990318-91990340 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1057621456 9:96639456-96639478 GTAGAACCTATGTTGTTCAAGGG + Intergenic
1057737040 9:97672621-97672643 TTCAAACCCATGTTGTTCAAGGG - Exonic
1058020590 9:100082795-100082817 TTCAAACCTATATTGTTCAAGGG + Intronic
1058579970 9:106445011-106445033 TTCAAACCTGTGTTATTCGAAGG - Intergenic
1058735783 9:107892848-107892870 TTTAAACCCATGTTGTTCGAGGG + Intergenic
1058844237 9:108940072-108940094 TTCAAACCTATGTTGCTCAAGGG - Exonic
1060652912 9:125345542-125345564 TTCAAACCCATGTTGTTCAAGGG + Intronic
1185843777 X:3417914-3417936 ATCTAACCTATGTTGTTCAAGGG + Intergenic
1186538187 X:10371600-10371622 TTCAAACCTATGTTGTTCCGGGG - Intergenic
1186730002 X:12399817-12399839 TTCAAACCCATGTTGTTCAAGGG + Intronic
1187062228 X:15797736-15797758 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1187342796 X:18436376-18436398 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1187538840 X:20170407-20170429 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1188786667 X:34355019-34355041 GTCAAGCCTATGTAAGTGGAAGG + Intergenic
1188902068 X:35746047-35746069 TTCAAACCTATGTTGTTCAAAGG - Intergenic
1189763780 X:44348436-44348458 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
1189979777 X:46497534-46497556 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1190814838 X:53920791-53920813 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1190823875 X:53999126-53999148 TTCAAACCCATGTTGTTCAAGGG - Intronic
1191672629 X:63762686-63762708 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1192113808 X:68392073-68392095 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1192609533 X:72553864-72553886 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1192666294 X:73090412-73090434 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1193319817 X:80108063-80108085 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1193570468 X:83135540-83135562 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1193744648 X:85261181-85261203 TTCAAACCTATGTTATTCAAGGG + Intronic
1194619749 X:96156244-96156266 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1194696597 X:97059870-97059892 TTCAAACCTATGATGTTCAAGGG + Intronic
1194936736 X:99959320-99959342 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
1194967230 X:100302453-100302475 TTCAAACCCATGTTGTTCAAGGG - Intronic
1195035774 X:100970743-100970765 TTCAAACCCATGTTGTTCAAGGG + Intronic
1195164673 X:102207475-102207497 TTCAAACCTCTGTTGTTCAAGGG - Intergenic
1195194185 X:102479616-102479638 TTCAAACCTCTGTTGTTCAAGGG + Intergenic
1195309250 X:103614913-103614935 GTCAAACCTGTGTTGTTCAAGGG - Intronic
1195385247 X:104308047-104308069 TTCAAACCCATGTCGTTCAAGGG - Intergenic
1195933577 X:110103880-110103902 CTCAAACCCATGTTGTTCAAGGG - Intronic
1196080157 X:111622158-111622180 TTCAAACCGATGTTGTTCAAGGG + Intergenic
1196571299 X:117268766-117268788 GGCAAACCAATGTAGCTAGACGG + Intergenic
1197136264 X:123063493-123063515 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1197155479 X:123265643-123265665 GTCAAACCTTTATGGTTCAAGGG + Intronic
1198303643 X:135356988-135357010 TTCAAACCCATGTTGTTCAATGG + Intronic
1198448394 X:136741241-136741263 TTCAAACCCATGTTGTTCAAGGG - Intronic
1198816641 X:140598569-140598591 TTCAAACCCATGTAGTTCAATGG - Intergenic
1199350221 X:146791344-146791366 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1199481807 X:148305902-148305924 TTCAAACCCATGTTGTTCTAGGG - Intergenic
1199506902 X:148573221-148573243 GTCAAAACTTTGTAGTTTGCTGG + Intronic
1199614285 X:149644119-149644141 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1199641357 X:149865575-149865597 TTCAAACCTACGTTGTTCAAGGG + Intergenic
1200809491 Y:7468040-7468062 TTCAAACCTGTGTTGTTCAAAGG + Intergenic
1201235847 Y:11910517-11910539 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1201645543 Y:16225909-16225931 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1201657270 Y:16359405-16359427 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1201735810 Y:17260300-17260322 TTTAAACCTATGTTGTTCAAGGG + Intergenic
1201895480 Y:18987765-18987787 TTCCAACCTATGTTGTTCAAGGG - Intergenic