ID: 1049050683

View in Genome Browser
Species Human (GRCh38)
Location 8:140192550-140192572
Sequence CTGACTGCACAGCTGGTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049050683 Original CRISPR CTGACTGCACAGCTGGTGCG AGG (reversed) Intronic
900281879 1:1875108-1875130 CGGGCTGCACAGCAGGTGAGAGG - Intronic
900397653 1:2459773-2459795 CTGAATGCAGTGCTGGCGCGTGG + Intronic
900750120 1:4390386-4390408 TTGACCGCACAGCTGGTTAGAGG - Intergenic
901053416 1:6437329-6437351 CGGTCTGCACAGCTGGTGGGGGG - Intronic
901573107 1:10177924-10177946 ACGACTGCACAGCTGGTAGGTGG + Intronic
901792038 1:11658762-11658784 CTGAACGCACAGCTGGTACTTGG - Exonic
902813630 1:18903529-18903551 CTGACTCCTAAGCAGGTGCGCGG - Intronic
904052281 1:27646917-27646939 CTCATTGCGCAGCTGGGGCGTGG - Intergenic
904434270 1:30484091-30484113 GTGACTGCACAGCTGTGGGGAGG - Intergenic
904895927 1:33818220-33818242 CTCTCTGCACAGCTGGTGTCTGG + Intronic
905140758 1:35842208-35842230 CAGGCTGCACAGCAGGTGAGTGG + Intronic
905347544 1:37321349-37321371 CCGTCTGCTCAGCTGGTGTGAGG - Intergenic
907588305 1:55641416-55641438 CTGGCTGGAGAGCTGGTGCTAGG - Intergenic
909109781 1:71460254-71460276 CTGACTGCAGAGCTTGTACTTGG - Intronic
911283921 1:95966345-95966367 CTCACTTCCCAGATGGTGCGGGG + Intergenic
912532431 1:110335935-110335957 CTGGCTGCACAGCAGGTGAGGGG + Intergenic
913125881 1:115789858-115789880 CTGACTGCAGAGTTGGTAAGAGG - Intergenic
913167282 1:116199967-116199989 CTGACAGCACAGCTGTTCCCTGG + Intergenic
913970723 1:143413776-143413798 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914065100 1:144239387-144239409 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914114051 1:144726967-144726989 CTGTCTGCACAGTTGGTCCTAGG + Intergenic
924282069 1:242448396-242448418 TTGACTGCACAGCTGATGTGTGG - Intronic
1063554607 10:7066351-7066373 CGGGCTGCACAGCAGGTGAGCGG - Intergenic
1063596636 10:7441478-7441500 ATCACTGCACAGCTGGGGCTGGG - Intergenic
1064185796 10:13161137-13161159 CTCACTGCACAGATGGTGAAGGG + Intergenic
1064344568 10:14520261-14520283 CTGACTGCCCAGCTGGTCATGGG + Exonic
1065489221 10:26265875-26265897 CTGACTGCCCATATGTTGCGGGG - Intronic
1067392583 10:45877733-45877755 CTGATTCCAGAGCTGGTGCAGGG + Intergenic
1067860908 10:49846849-49846871 CTGATTCCAGAGCTGGTGCAGGG + Intronic
1071197358 10:83176350-83176372 CTTGCTGCACAGCTGGTGGGGGG + Intergenic
1072273041 10:93795950-93795972 CTGACTACAGCGCTAGTGCGGGG - Intronic
1072766458 10:98098492-98098514 CTGACCGCACAGCAGGAGCTGGG - Intergenic
1072914939 10:99531913-99531935 TTGACTGCATTGGTGGTGCGTGG - Intergenic
1074528824 10:114282832-114282854 ATGTCTGCAAAGCTGGTGCTCGG - Intronic
1074696636 10:116055721-116055743 CTGTCAGCACAGATGGTGCGGGG - Intergenic
1076612873 10:131737405-131737427 CCGACTGCCCTCCTGGTGCGAGG + Intergenic
1076784509 10:132743187-132743209 CTGAGTGCAGCGCTGGTGGGTGG - Intronic
1076784528 10:132743245-132743267 CTGAGTGCAGCGCTGGTGGGTGG - Intronic
1076784547 10:132743303-132743325 CTGAGTGCAGCGCTGGTGGGTGG - Intronic
1076784566 10:132743362-132743384 CTGAGTGCAGCGCTGGTGGGTGG - Intronic
1076784584 10:132743421-132743443 CTGAGTGCAGCGCTGGTGGGTGG - Intronic
1077564752 11:3290506-3290528 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1077570642 11:3336323-3336345 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1083519159 11:63291594-63291616 CTGACTGGAATGCTGGTGGGAGG + Exonic
1084243405 11:67838232-67838254 CTGACTGATCAGCTGGTGGTGGG + Intergenic
1084774793 11:71368260-71368282 CTGGCTACACAGCTGGCGAGGGG - Intergenic
1084943567 11:72626996-72627018 CTGACTGCCTAGCTGGTCCCTGG + Intronic
1085122138 11:73974095-73974117 CTGACTCCACAGAGGGTGGGTGG - Intergenic
1089283733 11:117392431-117392453 CAGACTGTACAGCTGCTGTGTGG - Intronic
1089340022 11:117750930-117750952 CAGACTTCACAGCTGGGGCAGGG - Intronic
1090406560 11:126479265-126479287 CTGACTGCAGGGCTGCAGCGGGG - Intronic
1091335462 11:134762710-134762732 GCGGCTGCACAGCTGGTGCGTGG + Intergenic
1095927145 12:47590276-47590298 ATGACTACACAGCTTGTGAGGGG + Intergenic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1096753757 12:53781594-53781616 CTGACATCACAGATGGTGCAGGG + Intergenic
1100870916 12:98909068-98909090 ATGAGTGCAGAGCTGGTGTGTGG + Intronic
1101210063 12:102526507-102526529 CTGACTGCACAGCTGGAAGGTGG - Intergenic
1101804573 12:108052180-108052202 CTGAGTGCCCAGCTGTTGGGGGG + Intergenic
1102195954 12:111025317-111025339 TTTACTGCACAGCTGGTGAGGGG - Intergenic
1102639237 12:114351974-114351996 CAGATTACACAGCTGGTGTGTGG - Intergenic
1103812771 12:123628963-123628985 CTGACGGCACAGCAGGTCTGTGG + Intronic
1106395832 13:29380070-29380092 CTCATTGCACAGCTGATGAGTGG + Intronic
1106490706 13:30218806-30218828 GTGACTCCACAGCTGGGGCCTGG - Intronic
1108325302 13:49324700-49324722 CTGACTTCACAGATGGGGTGAGG + Intronic
1113547085 13:111161415-111161437 CTGATGGCACAGCTGGCGAGTGG - Intronic
1115965902 14:38887916-38887938 GAGACTGCACAGCTGGTGGAGGG - Intergenic
1117546572 14:56798323-56798345 CTGACTGCAGGGCTCGGGCGGGG + Intergenic
1118351319 14:64974092-64974114 AAGATTGCACAGCTGGTGAGTGG - Intronic
1119739680 14:77006251-77006273 CTGACAGCAAAGCTGGTGGAAGG - Intergenic
1121850189 14:97214574-97214596 CTGAGTTCACAGCTGGTTAGAGG - Intergenic
1122504855 14:102226040-102226062 CTGGCTGCACCGCAGGTGTGGGG + Intronic
1123544855 15:21329909-21329931 CTGACTGCATAGCTCGTGTTAGG - Intergenic
1128313971 15:66648482-66648504 CTTACTGCACAGCCTGTGCTGGG - Intronic
1128324279 15:66713680-66713702 CTGACTTCACAGCAGGAGAGGGG - Intronic
1129904268 15:79175072-79175094 ATGACTGCACGGCTGGAGCTGGG + Intergenic
1132472334 16:112474-112496 CTGACTGCTCTGCTGGTGTTGGG + Intronic
1133324194 16:4933465-4933487 CTGACTGCAGAGCTGGGTCTTGG + Intronic
1135269220 16:21054479-21054501 CAGATTGTCCAGCTGGTGCGAGG - Exonic
1135804934 16:25534270-25534292 CAGGCTGCACAGCAGGTGAGTGG - Intergenic
1136030735 16:27500963-27500985 ATGCCTGCACAGCTGCTGCTTGG + Intronic
1141096489 16:81166474-81166496 CTGACACCACGGCTGGTGCGGGG + Intergenic
1141592316 16:85077204-85077226 CTCAGTGCACAGCAGGTGCTGGG + Intronic
1141764058 16:86047087-86047109 CTGACTCCACAGGAGGTGTGAGG + Intergenic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1143035120 17:3990665-3990687 CTACCTGCACAGCCGGTGCCTGG + Intergenic
1143038389 17:4014680-4014702 CAGACTGCAAATATGGTGCGAGG + Intronic
1144836946 17:18161499-18161521 CTGGGTGGACAGCTGGTGGGAGG + Intronic
1144839585 17:18177655-18177677 CAGACTGCACAACTGGTAGGTGG - Intronic
1144947718 17:18978274-18978296 CTGCTTCCACAGCTGGTGCTGGG + Exonic
1147214949 17:38893622-38893644 CAGACCACACAGCTGGTGGGCGG - Intronic
1148344021 17:46891418-46891440 CTCACTGCACAGCTGGGCCCTGG - Intergenic
1150608084 17:66711581-66711603 CTGAGAGCACAGCTGGTGTGTGG - Intronic
1150945994 17:69746113-69746135 CGGACTGCACAGCTAGTGCTGGG + Intergenic
1151625374 17:75272421-75272443 GTGAGGGCACAGCTGGTGCCTGG - Intergenic
1152580201 17:81162451-81162473 CAGACTCCACACCTGGTGCCCGG + Intronic
1153915556 18:9741543-9741565 CCCACTGGACAGATGGTGCGTGG - Intronic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1160588566 18:79927144-79927166 CTGCCTGCTCAGCTGGAGTGGGG - Intronic
1160800678 19:966648-966670 CTGCTTGCACAGCTGCTGCCTGG - Exonic
1161478907 19:4501039-4501061 CAGACTGGACAGCAGGTGCTGGG + Intronic
1163129963 19:15266152-15266174 CTGCCTGCACAGCTGCTGGGAGG - Intronic
1164558523 19:29271533-29271555 GTGACAGCACAGCGGGTGAGAGG - Intergenic
1164844158 19:31417760-31417782 CCAACTGCAAAGCAGGTGCGTGG + Intergenic
1165210362 19:34231047-34231069 CAGCCTGCACAGCGGGTGAGAGG - Intergenic
1165636879 19:37347800-37347822 CTCATTGCTCAGCTGGAGCGAGG + Exonic
1166534351 19:43562962-43562984 GTAACTTCACAGCTGGTGGGTGG + Intronic
1167682142 19:50930249-50930271 CTGCCTGCACAGGTGTGGCGAGG - Intergenic
1168388052 19:55982575-55982597 CTGACTCCACAGTTGGTGCTGGG + Intronic
925234988 2:2270189-2270211 GTGCCTGCACATCTGGTGTGTGG - Intronic
925922200 2:8645500-8645522 CGGACCGCACCGCTGGGGCGAGG + Intergenic
926887118 2:17608413-17608435 CAGACTTCAAAGCTGGTGCCCGG + Intronic
927883362 2:26704304-26704326 CTGAATGCACAGCTTCTGCATGG + Intronic
932702381 2:74000737-74000759 CTGTCAACACAGCTGGTGAGTGG - Intronic
934175418 2:89574701-89574723 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934285734 2:91649064-91649086 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
936018429 2:108976880-108976902 CTGACTCCAGAGCTGGGGCAGGG - Intronic
936267200 2:111019768-111019790 CTCACTGCACGGCAGTTGCGGGG - Intronic
938779988 2:134576127-134576149 TTGACTGGTCAGCTGGAGCGGGG + Intronic
942333656 2:174856577-174856599 CTCCCTTCACAGCTGGTGCTTGG - Intronic
942644038 2:178091661-178091683 AGGACTGCACAGCTGTTGCAGGG + Intronic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
947875895 2:233468133-233468155 CTTTCTGCACTGCTGGTGGGTGG + Intronic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948141352 2:235674436-235674458 CTCACAGCACAGCTGGTTCCAGG - Intronic
949055111 2:241923460-241923482 TTGACTGCACAGCCGCTGCAGGG - Intergenic
949055132 2:241923613-241923635 TTGACTGCACAGCCGCTGCAGGG - Intergenic
1168834620 20:869804-869826 CTGACCCCACTGCTGGTGCCAGG + Intergenic
1169139970 20:3222155-3222177 CTGGCTACACAGCTGATGTGGGG - Intronic
1170544105 20:17418706-17418728 GTGTCTGCACAGCTGGTGGGAGG - Intronic
1172005368 20:31815848-31815870 GTGTCTGCACAGCTGGTGCAGGG + Intergenic
1172771583 20:37385398-37385420 CTGTCTGCACCGCTGGGGCCCGG - Intronic
1173984682 20:47251833-47251855 CTCACTTCCCAGATGGTGCGGGG - Intronic
1174550149 20:51356296-51356318 CTTACTCCACAGCTGGTGTTGGG + Intergenic
1175499349 20:59438891-59438913 CTGGCTGGACAGCTGGGGCCAGG - Intergenic
1175608449 20:60330462-60330484 CTGCCTGCCCACCTGGTGCTGGG + Intergenic
1175929054 20:62485032-62485054 CTTACTGCCCTGCTGGTGCAGGG - Intergenic
1176077833 20:63256543-63256565 CGGTCTGCACACCTGGTTCGCGG + Intronic
1176304956 21:5118479-5118501 GTGACAGCCCAGCTGGTGTGAGG - Intronic
1178296893 21:31417720-31417742 CTGACTGCACAGGTAGAGTGTGG - Intronic
1178590183 21:33902961-33902983 CTGTCTGGACAGCTGGTGTCAGG - Intronic
1178973309 21:37200480-37200502 CTTCCTGCAGAGCTGGTGTGAGG - Intronic
1179231101 21:39504484-39504506 CAGACTGCAGAGGTGGTGCGTGG - Intronic
1179242097 21:39601706-39601728 CTGTCAGCACGGCTGGTGGGAGG + Intronic
1179852099 21:44143551-44143573 GTGACAGCCCAGCTGGTGTGAGG + Intronic
1180126171 21:45791756-45791778 CTGACTGCACAGCAAGTGTTAGG + Intronic
1180214681 21:46316671-46316693 CTGACTGCAGAGCCAGTGCGAGG - Intronic
1182280180 22:29213924-29213946 CTTATGTCACAGCTGGTGCGTGG - Intronic
1183391721 22:37549135-37549157 CTTACTCCACAGCTGTTGGGAGG - Intergenic
1185031995 22:48449027-48449049 CTGACCTCACAGCTGGGACGTGG - Intergenic
1185271482 22:49931281-49931303 CTCACTGCACACCTGGGGCTGGG + Intergenic
950674573 3:14546843-14546865 GTCACAGCACAGCTGGTGGGGGG + Intergenic
950721806 3:14888424-14888446 CCTACTGCACAGCTGGGGCTGGG - Intronic
950757198 3:15185217-15185239 CTGCCTGCTGAGCTGGTCCGAGG + Intergenic
952506954 3:34016090-34016112 CTGAACTCACAGCTGGTGAGTGG - Intergenic
953018589 3:39099915-39099937 CTGCCTTCACAGCTGATGAGTGG - Intronic
953440000 3:42908819-42908841 CTGATTTCCCAGCTGGAGCGAGG + Exonic
957058973 3:75466203-75466225 CTGACTGATCAGCTGGTGGTGGG + Intergenic
961294473 3:125873528-125873550 CTGACTGATCAGCTGGTGGTGGG - Intergenic
962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG + Intronic
964800797 3:160555153-160555175 CTGACTGCTTAGCTGGTGTGTGG + Intronic
966563737 3:181352434-181352456 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
973933931 4:55822687-55822709 CAGATTTCACAGCTGGTGGGTGG - Intergenic
977929400 4:102734772-102734794 TGGACTGCACAGCTGGAGCCTGG - Intronic
981648661 4:147029682-147029704 GTGATTGCACAGATGGTGGGAGG - Intergenic
982301249 4:153881364-153881386 CTGCTTTCACAGCTGGTGTGAGG - Intergenic
984885680 4:184447144-184447166 CTGACTCCAGAGCTGGGGCAGGG + Intronic
985638694 5:1053031-1053053 CAGAATGCACAGCTGCTGTGGGG + Intronic
992207559 5:74445715-74445737 CTGACTGAACAGCAGGTCCTGGG + Intergenic
992378113 5:76209900-76209922 GTGACTGCCCAGCTGGGGCAAGG - Intronic
997294240 5:132759949-132759971 TTGACTGCACTCCTGGTGCTGGG + Intronic
999343747 5:150796437-150796459 CTGGCTGCAGAGCTGGTGGGAGG - Exonic
1000793076 5:165630740-165630762 CAGAGTCCACAGCTGGTGAGTGG - Intergenic
1001526120 5:172430085-172430107 CTAACTGCAAAGTTGGGGCGAGG + Intronic
1007461756 6:42024430-42024452 CTGATAACACAGCTGGTGTGTGG + Intronic
1009398278 6:63228071-63228093 CTCACTTCCCAGATGGTGCGGGG + Intergenic
1016641827 6:146358530-146358552 CTCACAGCACAGCTGGAGCTGGG + Intronic
1016923061 6:149315793-149315815 CTAAGTGCACTGCTGGTGCAAGG + Intronic
1019206893 6:170369331-170369353 CGCACTGCACAGCTGGTTCCAGG - Intronic
1020321835 7:6944541-6944563 CTGACTGATCAGCTGGTGGTGGG + Intergenic
1022556816 7:31306391-31306413 CTCACTGCACAGCAGGTACCAGG - Intergenic
1023489796 7:40726771-40726793 CTGACTGCACAGGTGCTGCTTGG + Intronic
1025247633 7:57329029-57329051 CTCACAGCACAGCAGGAGCGAGG + Intergenic
1026971767 7:74472890-74472912 CTGGCCCCACAGCTGGTGGGAGG + Intronic
1032892483 7:136213235-136213257 CTCACTTCCCAGATGGTGCGGGG + Intergenic
1034702745 7:153110708-153110730 ATGGCTGCACAGCTGGTTAGTGG + Intergenic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1038368331 8:26960929-26960951 CAGGCTGCACAGCAGGTGAGTGG + Intergenic
1040562957 8:48540853-48540875 CTGACTGCCCACCAGGTGCAAGG + Intergenic
1043962648 8:86434742-86434764 CTGAATGCATAGCTGGTACCTGG - Intronic
1044261871 8:90134495-90134517 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
1045750312 8:105476261-105476283 CGGGCTGCACAGCAGGTGAGTGG + Intronic
1048369630 8:133766236-133766258 CTGACTTCGCAGCTGGGGAGAGG + Intergenic
1048462610 8:134635089-134635111 CAGGCTGCACAGCAGGTGAGTGG - Intronic
1048820734 8:138378348-138378370 AAGACTGCACAGCTGCTGAGGGG - Intronic
1049050683 8:140192550-140192572 CTGACTGCACAGCTGGTGCGAGG - Intronic
1049388026 8:142354048-142354070 CTGACAGCAGAGCAGGAGCGGGG + Intronic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1057784991 9:98080701-98080723 CTGGCTGCACAGCTAGTGAGTGG + Intronic
1058929740 9:109707373-109707395 CTGACTTCAAAGCTGGGGCAGGG - Intronic
1059353491 9:113682688-113682710 GGGACTGTACAGCTTGTGCGGGG - Intergenic
1060182836 9:121545939-121545961 CGGACTCCACAGGTGGCGCGTGG + Intergenic
1061032141 9:128091776-128091798 CTGGCTACACAGCTGCTGGGAGG - Intronic
1061086803 9:128404422-128404444 CAGATGGCACAGCTGGTGGGTGG + Intergenic
1061934294 9:133848810-133848832 GTGACTGCACAGCCGGTGCCAGG - Intronic
1061949011 9:133925713-133925735 CTGACCCCACAGCTGATGCCTGG + Intronic
1062041706 9:134407413-134407435 CTGACTGCAGAGCTGGGTGGAGG + Intronic
1062233734 9:135498133-135498155 CTGACGGCACAGCTTGTGGGTGG - Intronic
1062246265 9:135568117-135568139 CTCATTGCCCAGCTGGTGGGTGG + Intergenic
1062536546 9:137023617-137023639 CTAAAGGCACAGCTGGTGCCTGG - Intronic
1188360445 X:29246449-29246471 CTGCCTGGACAGCTGATGAGGGG + Intronic
1195676721 X:107512322-107512344 CTGAGGGCAGAGCTGGTGGGGGG + Intergenic
1198640966 X:138756310-138756332 TTGACTGGACAGCTGGAGAGAGG - Intronic