ID: 1049053822

View in Genome Browser
Species Human (GRCh38)
Location 8:140219574-140219596
Sequence GGTTATAAGGGGGTCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049053822_1049053838 14 Left 1049053822 8:140219574-140219596 CCTTCCACGACCCCCTTATAACC 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1049053838 8:140219611-140219633 CCTCAGGGAGATGGGTTTAAGGG No data
1049053822_1049053833 5 Left 1049053822 8:140219574-140219596 CCTTCCACGACCCCCTTATAACC 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1049053833 8:140219602-140219624 CCCAGAATTCCTCAGGGAGATGG No data
1049053822_1049053836 13 Left 1049053822 8:140219574-140219596 CCTTCCACGACCCCCTTATAACC 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1049053836 8:140219610-140219632 TCCTCAGGGAGATGGGTTTAAGG No data
1049053822_1049053835 6 Left 1049053822 8:140219574-140219596 CCTTCCACGACCCCCTTATAACC 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1049053835 8:140219603-140219625 CCAGAATTCCTCAGGGAGATGGG No data
1049053822_1049053829 -2 Left 1049053822 8:140219574-140219596 CCTTCCACGACCCCCTTATAACC 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1049053829 8:140219595-140219617 CCCGCAGCCCAGAATTCCTCAGG No data
1049053822_1049053831 -1 Left 1049053822 8:140219574-140219596 CCTTCCACGACCCCCTTATAACC 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1049053831 8:140219596-140219618 CCGCAGCCCAGAATTCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049053822 Original CRISPR GGTTATAAGGGGGTCGTGGA AGG (reversed) Intronic
903448172 1:23435820-23435842 GGTTATAAGTGGCCCTTGGAGGG + Intronic
906100559 1:43257721-43257743 GATTATAAGGGGGTCCTGCCTGG - Intronic
909014883 1:70370609-70370631 GGTTGTAGAGGGGTTGTGGAGGG - Intronic
909444997 1:75738850-75738872 GGATAAAAGGGGGTGGTAGAAGG - Intronic
911850383 1:102811184-102811206 GCTTTTAAGGGGTTCCTGGATGG + Intergenic
912427616 1:109608695-109608717 GGTCATTAGGAGGTTGTGGAAGG - Exonic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
918217528 1:182405628-182405650 AGTTTTAAGGGGATCATGGAGGG - Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
920425567 1:205872430-205872452 GGTTATGGAGGGGTTGTGGAAGG - Intergenic
920739862 1:208570365-208570387 GGTTATCAGGGGCTAGGGGAAGG - Intergenic
922707095 1:227795524-227795546 GGGAAGAAGGGGGTGGTGGAGGG - Intergenic
924254309 1:242167140-242167162 GGCTATAACAGGGTCCTGGATGG + Intronic
924633592 1:245764599-245764621 GGTTAAAAGGGGGGTGTGGTAGG - Intronic
1062954207 10:1529583-1529605 GGTGATAAGGGTGTCGGTGAGGG - Intronic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1071781590 10:88852474-88852496 GGTTATAATGGGTGTGTGGACGG - Intergenic
1075013995 10:118896758-118896780 GGTTATGGAGGGGTTGTGGAGGG - Intergenic
1076291591 10:129349737-129349759 GGATATGAGGGCTTCGTGGAGGG - Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079230677 11:18646249-18646271 GGTTATGGAGGGGTTGTGGAGGG - Intergenic
1081894909 11:46577441-46577463 GGTTATCAGGGGCTGGAGGAAGG + Intronic
1082197604 11:49323931-49323953 GGTTGTAGAGGGGTTGTGGAGGG + Intergenic
1084609912 11:70195394-70195416 GGAGGTAAGGGGGTAGTGGAAGG + Intergenic
1086658222 11:89384196-89384218 GGTTGTAGAGGGGTTGTGGAGGG - Intronic
1088605462 11:111526075-111526097 GGTCAGAAGGAGGTGGTGGAGGG + Intronic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1090414113 11:126529015-126529037 GGTTGTCAGGTGGACGTGGAGGG + Intronic
1091877747 12:3950516-3950538 GGTTATGAGGGAGGAGTGGAAGG - Intergenic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1093697748 12:22181305-22181327 GGTTGTAAGGTGGTAGGGGAGGG - Intronic
1094360904 12:29629648-29629670 GGTTATCAGGGGATGGAGGAGGG + Intronic
1095998858 12:48112628-48112650 GGTTATGGAGGGGTTGTGGAGGG + Intronic
1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG + Intergenic
1099847079 12:88041111-88041133 GGTTACAAGGGGCTGGTGGTGGG - Intronic
1102116582 12:110407788-110407810 GGTTATGGAGGGGTTGTGGAGGG + Intergenic
1102757233 12:115352085-115352107 GGTTTTCAGGGGCTAGTGGAGGG - Intergenic
1106610608 13:31276023-31276045 GGTAATAAAGGGGTCATGAAGGG + Intronic
1114494558 14:23123715-23123737 GGGAGTAAGGGGGTGGTGGAGGG - Intergenic
1118452540 14:65917265-65917287 GGTTTTAAGAGGGTGGTGAATGG + Intergenic
1119560107 14:75583170-75583192 GGTTATGGAGGGGTTGTGGAGGG + Intronic
1121131031 14:91447581-91447603 GGTAGTAAGGGGGTCGGGGTGGG + Intergenic
1122600961 14:102921692-102921714 GGTAATCAGGGAGTGGTGGATGG - Intergenic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1129237602 15:74233112-74233134 GGAGATAAAGGGGTCGAGGAAGG - Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134535020 16:15019324-15019346 GGTTACAAGGTGGTTATGGAGGG + Intronic
1135514273 16:23116725-23116747 GGTTTGAAGGGTGTGGTGGAGGG - Intronic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138386456 16:56638672-56638694 GGCTATAAGGCGCACGTGGAAGG - Exonic
1139469139 16:67169101-67169123 GGTAAGAAGTGGGTCGGGGAGGG + Exonic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1140210998 16:72970113-72970135 GGTTACAGTGGAGTCGTGGAGGG + Intronic
1140835175 16:78787332-78787354 GGTTATGAGGGGCTGGGGGAAGG - Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1143414189 17:6734139-6734161 GGTTATGGAGGGGTTGTGGAGGG + Intergenic
1147160755 17:38568258-38568280 GGTTATGAGGGGGCCCAGGAGGG + Intronic
1148737829 17:49874670-49874692 GGTTGTTAGGTGGGCGTGGAGGG - Intergenic
1148810007 17:50284296-50284318 GGATTTGAGGGGGTGGTGGAGGG - Intergenic
1152048710 17:77956635-77956657 AGTTATAAGGTGGTGGTGGCAGG + Intergenic
1154354734 18:13616286-13616308 GCTTGAAAGGGGGTCATGGAGGG + Intronic
1157473013 18:48004062-48004084 GGCTATAAGGAGGACGGGGACGG - Intergenic
1157475532 18:48021189-48021211 GGTTAGAAGGGAGTAGAGGAGGG - Intergenic
1161066137 19:2238784-2238806 GAGGATAAGGGGGTCTTGGAGGG - Intronic
1161829118 19:6590081-6590103 GGTAACACGGGGGACGTGGAGGG - Exonic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1163944296 19:20521611-20521633 GGTTATGGAGGGGTTGTGGAGGG + Intergenic
1165046449 19:33108558-33108580 GATTATATGGTGGTCGGGGAAGG - Intronic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
925433693 2:3818398-3818420 GGTTATGGAGGGGTTGTGGAGGG + Intronic
929163686 2:38859356-38859378 GGTTATGAGGGGCTGGGGGAAGG + Intronic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929684365 2:44021541-44021563 GGTTATGGAGGGGTTGTGGAGGG + Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
931161116 2:59691600-59691622 GGTTAAAAGGGGATGGTGGAAGG + Intergenic
933138100 2:78761113-78761135 GGTTATGGAGGGGTTGTGGAGGG - Intergenic
933310040 2:80649370-80649392 AGCTATAAGGGAGTTGTGGAAGG + Intergenic
937663960 2:124463152-124463174 GGGTATAAGGGGGATGTGAATGG + Intronic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938714764 2:134009405-134009427 AGTTATATCTGGGTCGTGGAAGG + Intergenic
940216990 2:151312045-151312067 GGTTATGGAGGGGTTGTGGAGGG - Intergenic
945871995 2:215237501-215237523 GGTTGTAAGGGGGTAGATGAGGG - Intergenic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
948546107 2:238730030-238730052 GGTGGTATGGGGGTCGTTGAAGG - Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1179885229 21:44311006-44311028 GGCTATGAGGGCCTCGTGGAGGG + Exonic
1181235411 22:21445415-21445437 CGGTATCAGGGGCTCGTGGATGG + Exonic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
952411666 3:33054950-33054972 GGTTATCAGAGGGTCTTGGCTGG - Intronic
952791998 3:37207292-37207314 GGTTATGGAGGGGTTGTGGAGGG - Intergenic
958802007 3:98766808-98766830 GGTTATTAGATGGTCCTGGAAGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
963920555 3:150900982-150901004 GGGTACAAGGGAGACGTGGATGG - Intronic
964175864 3:153825771-153825793 GGTTATGCAGGGGTTGTGGAGGG + Intergenic
964649249 3:158992400-158992422 AGTTATAAGGGGATAGTGGGGGG - Intronic
966938745 3:184731817-184731839 GCTTTCAAGGGGGTCTTGGAGGG + Intergenic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
969430586 4:7151543-7151565 GGTTATGAGGGGCAGGTGGAGGG + Intergenic
969631568 4:8341682-8341704 GGTGGTGAGGGGGACGTGGAGGG + Intergenic
970966649 4:21935664-21935686 GAATATGTGGGGGTCGTGGAGGG - Intronic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
981226732 4:142304584-142304606 GGTTATAAGTGGGTCCTTGGCGG + Intronic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
984411903 4:179406504-179406526 GGTTATGGAGGGGTTGTGGAGGG - Intergenic
986297409 5:6450135-6450157 GGTCCTAAGGGGTTCGGGGAAGG - Intronic
986920712 5:12676076-12676098 GATTTTGAGGGGATCGTGGAGGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990329821 5:54714606-54714628 GGTTCTGAGGGGGTGGTGGCAGG + Intergenic
992247982 5:74847297-74847319 GGTTACCAGGGGGTGGTGGGGGG - Intronic
992451834 5:76882884-76882906 GGTTATGGAGGGGTTGTGGAGGG + Intronic
993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG + Intergenic
995229613 5:109744276-109744298 GGCAAGAAGGGGGTCTTGGAAGG + Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
1009548569 6:65055902-65055924 TGTAAAAAGGGGGTCATGGAGGG - Intronic
1013807922 6:114014835-114014857 GGTTATGGAGGGGTTGTGGAGGG + Intergenic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1018180552 6:161219491-161219513 GGTTATAAGGCGATCGTGTGTGG - Intronic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1021172837 7:17417054-17417076 GGTTATAGAGGGGTTGTAGAGGG - Intergenic
1025254464 7:57374144-57374166 GGGTAAAAGGGAGTCATGGAAGG + Intergenic
1026286037 7:68963581-68963603 TTTTATAAGGGGATCCTGGAGGG + Intergenic
1026476637 7:70741805-70741827 GGTTATAGTGGCGTGGTGGAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027791687 7:82643555-82643577 GGTAATTAGGAGGTAGTGGAAGG - Intergenic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1031704448 7:124963139-124963161 GGTTACAGAGGGGTTGTGGAAGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1035091873 7:156319552-156319574 GGTGATAAGGGTTTCGTGGCTGG + Intergenic
1035528335 8:332110-332132 GCTCATAAGGGGGTCGGGGAGGG - Intergenic
1036262171 8:7249645-7249667 GGTCACAAGGGGGACGGGGACGG - Intergenic
1036304419 8:7589913-7589935 GGTCACAAGGGGGGCGGGGACGG + Intergenic
1036314210 8:7708184-7708206 GGTCACAAGGGGGACGGGGACGG - Intergenic
1036355271 8:8037905-8037927 GGTCACAAGGGGGGCGGGGACGG + Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1041792906 8:61715874-61715896 GGTTGTAAGGGGGCCCTGAATGG - Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1044838826 8:96320812-96320834 GGTTATAACGTGGACCTGGAGGG - Intronic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048080600 8:131122412-131122434 GGTCTTAAGGGGGTCTTGGTAGG - Intergenic
1049053822 8:140219574-140219596 GGTTATAAGGGGGTCGTGGAAGG - Intronic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1052334984 9:27309905-27309927 GGTTATCAGGGGCTGGTGGTGGG + Intergenic
1056363862 9:85883902-85883924 GGTTATGGAGGGGTTGTGGAGGG - Intergenic
1060052273 9:120385905-120385927 GCTTGTAAGTGGGTGGTGGAAGG - Intergenic
1060446932 9:123698117-123698139 GATCATATGGGGGTTGTGGAGGG + Intronic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186316397 X:8375154-8375176 AGTTTTAAGGGGCTCTTGGAGGG - Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1195529160 X:105932010-105932032 GGTTATCAGGGGTTAGAGGAGGG - Intronic
1195710491 X:107769461-107769483 GGTTACCAGGGGGTAGTGGGAGG + Intronic
1198010909 X:132552875-132552897 GGTTATCAGGAGGTGGGGGAAGG + Intergenic
1198966082 X:142229760-142229782 GGTTATAGAGGGGTTGTGGAGGG - Intergenic
1200812997 Y:7503941-7503963 GGTTATGGAGGGGTTGTGGAGGG - Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic