ID: 1049054563

View in Genome Browser
Species Human (GRCh38)
Location 8:140225640-140225662
Sequence GGTCCGCTTGACCTGGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049054563_1049054565 -8 Left 1049054563 8:140225640-140225662 CCAGGAACCAGGTCAAGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1049054565 8:140225655-140225677 AGCGGACCTCTAAGCAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049054563 Original CRISPR GGTCCGCTTGACCTGGTTCC TGG (reversed) Intronic
910183677 1:84512058-84512080 GTTCTGCTTTATCTGGTTCCTGG - Intergenic
911093843 1:94039748-94039770 GGTCCCCCTGCCCTGGCTCCAGG - Intronic
911822108 1:102435809-102435831 GGCCTGCTTTAGCTGGTTCCAGG - Intergenic
916579564 1:166095416-166095438 TGTCTGCCTGTCCTGGTTCCTGG - Intronic
1064194330 10:13233266-13233288 GGTCCTCTTGTCCTGCTTCTTGG - Intronic
1066748434 10:38627195-38627217 GGGCTGCTTGCCCTGGATCCTGG - Intergenic
1066968243 10:42290580-42290602 GGGCTGCTTGCCCTGGATCCTGG + Intergenic
1067231899 10:44417975-44417997 GGCCTGTGTGACCTGGTTCCGGG - Intergenic
1067498148 10:46777139-46777161 GGTTTGCGTGACCTGGTTGCAGG + Intergenic
1067596495 10:47563276-47563298 GGTTTGCGTGACCTGGTTGCAGG - Intergenic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1077080337 11:722151-722173 GGGCCTCTGGACCTGGTGCCTGG + Exonic
1077554240 11:3218309-3218331 GGCCAGCGTCACCTGGTTCCTGG - Exonic
1085825962 11:79847192-79847214 GGGGTGCTTGCCCTGGTTCCTGG + Intergenic
1095815047 12:46412139-46412161 GGAACTCTTGACCTGGTTACAGG - Intergenic
1101207389 12:102502248-102502270 GGTCCCCTTGACCTGCTTCAGGG + Intergenic
1102598189 12:114008882-114008904 GGTCTGCTTGCCCTGGCTGCTGG - Intergenic
1104736985 12:131141016-131141038 GGTCCATGTGACCTGGTTTCTGG - Exonic
1123067203 14:105624722-105624744 GGTCAGGCTGACCTGGTTCTTGG + Intergenic
1123071222 14:105643449-105643471 GGTCAGGCTGACCTGGTTCTTGG + Intergenic
1123076185 14:105668492-105668514 GGTCAGGGTGACCTGGTTCTTGG + Intergenic
1123090881 14:105741719-105741741 GGTCAGGCTGACCTGGTTCTTGG + Intergenic
1123096518 14:105769483-105769505 GGTCAGGCTGACCTGGTTCTTGG + Intergenic
1128731552 15:70024897-70024919 GGTCAGCTTGGCCTGGGTTCGGG - Intergenic
1132941299 16:2509736-2509758 GGCACTCTTGACCTGCTTCCAGG - Intronic
1133720043 16:8486272-8486294 GCTCCTCATGACCTGGTTTCTGG - Intergenic
1135255272 16:20936648-20936670 GGCCCGCCTGACCTTCTTCCAGG - Exonic
1138194533 16:55042831-55042853 AGTCCACTTGACATGTTTCCAGG - Intergenic
1138675743 16:58649847-58649869 GCTCCGATTGACCTAGTGCCAGG + Intergenic
1139426731 16:66885216-66885238 GGACAGCTCGGCCTGGTTCCAGG - Exonic
1141004768 16:80341689-80341711 GGGCCTCTTGACCTGGCCCCGGG + Intergenic
1141429688 16:83965253-83965275 GGGCTGCTGGGCCTGGTTCCTGG - Exonic
1142345743 16:89552957-89552979 GGTCATCTTGACCTTGTGCCAGG + Exonic
1143568383 17:7739079-7739101 GCCCCGTTTGCCCTGGTTCCTGG - Intronic
1150494222 17:65594805-65594827 GGTCCCCTTGGCCTGGGTTCTGG + Intronic
1156468325 18:37362014-37362036 GGTCCCCTTCACCTGGGTCCTGG + Intronic
1160516836 18:79483451-79483473 GTCCAGCGTGACCTGGTTCCTGG + Intronic
1160708801 19:541335-541357 GGTCCCCAGGACCTGCTTCCTGG - Exonic
1167236381 19:48318495-48318517 AAGCCGCTTGACCTGGTTCTGGG + Exonic
934311409 2:91869337-91869359 GGGCTGCTTGCCCTGGATCCTGG - Intergenic
935306514 2:101742071-101742093 GGGCTGTGTGACCTGGTTCCAGG + Intronic
936918931 2:117668076-117668098 GTCCCTCTAGACCTGGTTCCTGG + Intergenic
948687305 2:239677370-239677392 TGTCGTCATGACCTGGTTCCTGG + Intergenic
1169049304 20:2562490-2562512 GGCCAGCTTGGCCTGGTGCCAGG - Intronic
1170006555 20:11676125-11676147 GGCCCGGATGACTTGGTTCCTGG + Intergenic
1180538163 22:16415140-16415162 GGGCTGCTTGCCCTGGATCCTGG - Intergenic
1181555669 22:23670485-23670507 GGTCCACTTGCCCGGTTTCCAGG + Intergenic
968737042 4:2303104-2303126 GGTGGGCTGGGCCTGGTTCCCGG - Intronic
969643361 4:8412323-8412345 GGTCCGCTTGAGTTCATTCCTGG + Intronic
969851898 4:9964008-9964030 GGTCCGTATGACCTGGCTCCAGG - Intronic
973120097 4:46511150-46511172 GGTCAGCTGGACCTGTCTCCAGG - Intergenic
981045417 4:140260455-140260477 GGTCATCTTGACCAGTTTCCTGG + Intronic
986433898 5:7709282-7709304 GGTCCGCATGACCCGGTACTTGG + Exonic
991403378 5:66277486-66277508 GGTCTGCTTGAGAGGGTTCCAGG + Intergenic
997827337 5:137118364-137118386 GGTGCTCCTGTCCTGGTTCCTGG + Intronic
999274869 5:150323505-150323527 GGTCCAGGTGTCCTGGTTCCCGG - Intronic
1016728827 6:147406522-147406544 GGTCCCTTCGACATGGTTCCTGG - Intergenic
1019118049 6:169781597-169781619 GGTCTGCTTGGCCAGGGTCCAGG + Intergenic
1020076740 7:5263412-5263434 GATCCATTTGTCCTGGTTCCTGG - Intergenic
1020817729 7:12926389-12926411 GGTCAGCTTTAACTTGTTCCTGG + Intergenic
1022566140 7:31404391-31404413 TGACCGCTTTACCTTGTTCCTGG + Intergenic
1023981505 7:45073272-45073294 GGTCAGCTTGGCCTGGTCCTGGG - Intronic
1025202353 7:56970182-56970204 GATCCATTTGTCCTGGTTCCCGG + Intergenic
1025669595 7:63606745-63606767 GATCCATTTGTCCTGGTTCCCGG - Intergenic
1030669929 7:112325089-112325111 AGTCAGCTTGACCTGGTTAAAGG - Intronic
1039923171 8:41907109-41907131 TGGCCGCGTGACCTGGTTCTGGG - Intergenic
1049054563 8:140225640-140225662 GGTCCGCTTGACCTGGTTCCTGG - Intronic
1060821595 9:126664435-126664457 GGGCCCCTTGGCCTGGTTCAAGG - Intronic
1062651671 9:137580955-137580977 GGTCCCCTTTACCTGCATCCAGG - Intergenic
1187847587 X:23556776-23556798 GGTGCTCTTAATCTGGTTCCAGG + Intergenic
1191897426 X:66007783-66007805 GTTCCTGATGACCTGGTTCCTGG - Intergenic