ID: 1049055893

View in Genome Browser
Species Human (GRCh38)
Location 8:140237291-140237313
Sequence CCCTGCGATGATGAGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049055893_1049055895 1 Left 1049055893 8:140237291-140237313 CCTCAAAACTCATCATCGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1049055895 8:140237315-140237337 ACAGAGAATAAGCAGCAACTAGG No data
1049055893_1049055896 10 Left 1049055893 8:140237291-140237313 CCTCAAAACTCATCATCGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1049055896 8:140237324-140237346 AAGCAGCAACTAGGTCTGCCTGG No data
1049055893_1049055897 27 Left 1049055893 8:140237291-140237313 CCTCAAAACTCATCATCGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1049055897 8:140237341-140237363 GCCTGGAGAAACCCAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049055893 Original CRISPR CCCTGCGATGATGAGTTTTG AGG (reversed) Intronic
906194617 1:43922068-43922090 CCCAGCTATGATGAATTTTAAGG - Intronic
909470261 1:76019940-76019962 ATCTGCCATGATGAGTTTTGAGG + Intergenic
912880222 1:113404810-113404832 CCTTGGGGTGAAGAGTTTTGTGG - Intronic
913573290 1:120142923-120142945 CCCTCTGATGAGGAGTCTTGTGG - Intergenic
914294549 1:146307720-146307742 CCCTCTGATGAGGAGTCTTGTGG - Intergenic
914555593 1:148758503-148758525 CCCTCTGATGAGGAGTCTTGTGG - Intergenic
923228477 1:231961444-231961466 TCGTGCGATGCTGAGGTTTGGGG + Intronic
923384530 1:233453386-233453408 CCCTGCAAAGATGTCTTTTGTGG + Intergenic
924825943 1:247539051-247539073 CACTGAAATGATGAGTTTTGTGG + Intronic
1065382987 10:25108622-25108644 CCCTGCAATGCTGTCTTTTGTGG + Intergenic
1067576547 10:47412354-47412376 CCCTGAGATGATGGTTTTTGGGG + Intergenic
1068379875 10:56238246-56238268 CCCTGCCCTGATTAGTTTTGAGG - Intergenic
1072966062 10:99973760-99973782 ACCTGAGGTGAGGAGTTTTGAGG + Intronic
1075134032 10:119766351-119766373 CCCTGTGATGGTTAATTTTGTGG - Intronic
1075689458 10:124385791-124385813 TCATGCAATGATGGGTTTTGTGG + Intergenic
1076734226 10:132451617-132451639 CCCTGGAATGCTGTGTTTTGGGG - Intergenic
1077991586 11:7416877-7416899 GCCTGGGATGATGATATTTGAGG - Intronic
1085805782 11:79634782-79634804 CCCTGCCTTGAGGAGTTTTGAGG + Intergenic
1086812536 11:91328725-91328747 CTCTGTGATCATGAATTTTGGGG + Intergenic
1087212086 11:95454847-95454869 CACTGCATTGATGAGATTTGTGG - Intergenic
1088604430 11:111514597-111514619 CCCTGCGGTGATCAGGTTTTAGG - Intergenic
1090480483 11:127063371-127063393 CCATACGATGATGTGTTTGGTGG - Intergenic
1092010079 12:5102314-5102336 CTCTAAGATGCTGAGTTTTGTGG + Intergenic
1099094529 12:78356597-78356619 CCCTGCAAAGGTGAGCTTTGTGG - Intergenic
1100078799 12:90823537-90823559 CACTGTGATGATGATGTTTGGGG + Intergenic
1100695906 12:97092722-97092744 CCCAGCCATGATGAATTTTTGGG + Intergenic
1106409402 13:29500489-29500511 CCATGGGATGATGGGATTTGGGG + Intronic
1107871674 13:44752276-44752298 CCCTGTGAGGAAGAGTTATGCGG + Intergenic
1107975772 13:45687544-45687566 CTCTTCCATGAAGAGTTTTGAGG - Intergenic
1111081789 13:83321165-83321187 CCCAGCCATGCTGAATTTTGAGG - Intergenic
1113343994 13:109455847-109455869 CCCTCCGATGATGACCCTTGTGG + Intergenic
1113598855 13:111554257-111554279 CCCTGCAAAGCTGTGTTTTGTGG + Intergenic
1114526790 14:23371534-23371556 CTCTGCTCTGATGAGTCTTGGGG - Intergenic
1115887997 14:37995052-37995074 CCCTGCAATGCTGTCTTTTGTGG + Intronic
1117268935 14:54121324-54121346 CACTCCAAAGATGAGTTTTGTGG + Intergenic
1120288117 14:82531304-82531326 CTTTGAGATAATGAGTTTTGAGG + Intergenic
1121232428 14:92367508-92367530 ACCTGGGAAGATGAGATTTGAGG + Intronic
1122388365 14:101364114-101364136 CCCTGCTGTGGTCAGTTTTGTGG + Intergenic
1125235314 15:37506137-37506159 CCCTGTGATGCTGAGGTTTAGGG - Intergenic
1128020851 15:64388986-64389008 CCCTTCGTTGATGAGTGCTGAGG + Intronic
1129989587 15:79950510-79950532 TCCTGGGATTATGGGTTTTGGGG + Intergenic
1132763731 16:1524076-1524098 CTCTGCGGTGATGGGTTTTAAGG + Intronic
1133760603 16:8795815-8795837 CCCTGGGAACATGTGTTTTGTGG - Exonic
1139939690 16:70596287-70596309 CCTTGAGGTGATGAATTTTGGGG + Intronic
1140470838 16:75213486-75213508 CCCTTCCATGCAGAGTTTTGTGG + Intergenic
1141837053 16:86548143-86548165 ACCTGCGATGTTCAGTATTGTGG - Intronic
1148989659 17:51654492-51654514 CCCTGAGATGATGAATTTTAAGG - Intronic
1152588896 17:81201452-81201474 TCCTGTGATGATGACTGTTGGGG - Intronic
1154443267 18:14411898-14411920 CCCTGAGATGAGGAGTCATGTGG - Intergenic
1154503419 18:15008093-15008115 CTCTGTCATGTTGAGTTTTGGGG + Intergenic
1156121199 18:33845072-33845094 CCCTGTGTTGATGAGTGGTGGGG - Intergenic
1156693246 18:39734337-39734359 CTCTGGGGAGATGAGTTTTGTGG + Intergenic
1157945722 18:51978304-51978326 GCCTGAGGTTATGAGTTTTGGGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
929792110 2:45031051-45031073 CTGTGTGAAGATGAGTTTTGGGG + Intergenic
934916606 2:98305403-98305425 CCCTGCCCTCATTAGTTTTGTGG + Intronic
936079766 2:109424109-109424131 CCCTGAGATGGGGAGGTTTGTGG + Intronic
937799054 2:126059966-126059988 CCCTGCGAAGATGTGTGTTTGGG + Intergenic
938502589 2:131838224-131838246 CTCTGTCATGTTGAGTTTTGGGG + Intergenic
939100958 2:137894609-137894631 CCCTGAGATGAGGAGTCATGTGG + Intergenic
939961428 2:148569189-148569211 CACTGCGTTGATGCGTCTTGTGG + Intergenic
940577919 2:155537111-155537133 CACTGAGGTTATGAGTTTTGGGG + Intergenic
943779272 2:191803966-191803988 CCCTTCGATGATCATTTTTCTGG - Intergenic
945365886 2:208953250-208953272 GCCTTGGATGATCAGTTTTGGGG - Intergenic
946131983 2:217613474-217613496 CCCTTTGTTGATGAGCTTTGGGG + Intronic
1176452823 21:6879310-6879332 CCCTGAGATGAGGAGTCATGTGG + Intergenic
1176830996 21:13744359-13744381 CCCTGAGATGAGGAGTCATGTGG + Intergenic
1176975844 21:15320787-15320809 CCTTGAGAAGATGAGTTATGAGG - Intergenic
1178830981 21:36056348-36056370 CCCTGTGATGTAGAATTTTGGGG + Intronic
1179562573 21:42225172-42225194 ACCTGAGCTGCTGAGTTTTGTGG - Intronic
1180580628 22:16832747-16832769 CCCTGAGATGTTGATTTTTCTGG + Intergenic
1183332614 22:37229550-37229572 CCCTGGGATGACAAGTTTTGGGG - Intronic
949204242 3:1419331-1419353 CTCTTCTATGAAGAGTTTTGAGG + Intergenic
950689589 3:14645300-14645322 GCATGGGATCATGAGTTTTGGGG - Intergenic
955851537 3:63225115-63225137 CCCTGCAATTGTGGGTTTTGTGG - Intergenic
956229964 3:67002987-67003009 CCCTGAGAATATGGGTTTTGAGG + Intronic
960853038 3:122075626-122075648 GACTGGAATGATGAGTTTTGAGG + Intronic
964252225 3:154731581-154731603 CTGTGTGATGCTGAGTTTTGGGG - Intergenic
965159507 3:165113990-165114012 CACTTTGATGAAGAGTTTTGAGG + Intergenic
968442192 4:629594-629616 CCCCGTGATGAGGTGTTTTGGGG - Intronic
968653780 4:1770129-1770151 CCCTGCCATGAAGTGTCTTGGGG - Intergenic
974488105 4:62529699-62529721 CCCTGCAAAGCTGTGTTTTGTGG - Intergenic
974681359 4:65167808-65167830 TCCTGCCATGTTGAGTTTTAGGG + Intergenic
976318628 4:83686330-83686352 CACTGCCCTGATGAGTTGTGTGG + Intergenic
976904398 4:90218395-90218417 CCGTGTGATGCTGGGTTTTGGGG - Intronic
979620498 4:122793718-122793740 CTCTGCCATGATGAGTCATGGGG - Intergenic
982554849 4:156847351-156847373 CACTGAGATTATAAGTTTTGGGG - Intronic
982684993 4:158477490-158477512 CTCTCCGATAATGATTTTTGAGG + Intronic
984221468 4:176982929-176982951 CCGTGTGATGCTGAGGTTTGGGG + Intergenic
986660737 5:10057639-10057661 CCCTGGGAAGATGAGAGTTGGGG - Intergenic
992773389 5:80069503-80069525 CCCTGGGATGATGGGTGATGGGG + Intronic
1001058058 5:168465452-168465474 CCCTGCTATAATGAGTTTAAGGG + Intronic
1002906441 6:1452997-1453019 CCCCGCGATGCTGCCTTTTGTGG + Intergenic
1009279306 6:61726514-61726536 GGCTGAGATGATGAGTTTTCTGG - Intronic
1019062191 6:169264559-169264581 CAGTGCAATGATGAGTTTTGAGG + Intergenic
1023649313 7:42351979-42352001 CCTTGAGAGGCTGAGTTTTGTGG + Intergenic
1026975956 7:74498562-74498584 CCCTGAGTTGATGACTGTTGAGG - Intronic
1034872460 7:154696279-154696301 CCCTGGGGTGATGAGGATTGAGG + Intronic
1040613610 8:49011945-49011967 CCCTGCTATAATGAGATGTGGGG - Intergenic
1042006383 8:64184392-64184414 CCCTGAGATCAGGAGTTTGGTGG - Intergenic
1047654000 8:126955618-126955640 CCCTGCTATGGTGAGTATGGAGG + Intergenic
1048047431 8:130786022-130786044 CACTGCAAAGATGAGATTTGAGG - Intronic
1049055893 8:140237291-140237313 CCCTGCGATGATGAGTTTTGAGG - Intronic
1049425768 8:142537279-142537301 GCCTGAGCTGATGAGTTTGGAGG + Intronic
1055017949 9:71639338-71639360 CTCTGGGATGAATAGTTTTGTGG - Intergenic
1055045627 9:71921189-71921211 CCCTGCAAAGCTGTGTTTTGTGG + Intronic
1057327772 9:94081612-94081634 GCCTCCGATGATCTGTTTTGAGG - Intronic
1058771966 9:108243769-108243791 CCGTTGGATGATGAGATTTGAGG - Intergenic
1060172277 9:121471689-121471711 CCCTGAGATGACGAGTTTGCTGG + Intergenic
1060567443 9:124605745-124605767 CCCTTCGATGATGGTTGTTGAGG + Intronic
1203516358 Un_GL000213v1:5205-5227 CCCTGAGATGAGGAGTCATGTGG - Intergenic
1193506448 X:82349823-82349845 CCCTGCTATGAGGAGTAGTGGGG - Intergenic
1194378290 X:93163222-93163244 CCTTGCAATTCTGAGTTTTGGGG - Intergenic
1195172455 X:102282181-102282203 GCCTGCCATGGTGAGGTTTGTGG + Intergenic
1195186409 X:102404914-102404936 GCCTGCCATGGTGAGGTTTGTGG - Intronic
1199110911 X:143933009-143933031 CCTTGTGATGCTGAGTTTTGGGG + Intergenic