ID: 1049055913

View in Genome Browser
Species Human (GRCh38)
Location 8:140237508-140237530
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049055909_1049055913 -10 Left 1049055909 8:140237495-140237517 CCAGTTAAATCTCCAAATTTAGG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1049055913 8:140237508-140237530 CAAATTTAGGACTAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr