ID: 1049057979

View in Genome Browser
Species Human (GRCh38)
Location 8:140254177-140254199
Sequence CTGCAGGAGCAGAGTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 1, 2: 6, 3: 72, 4: 579}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049057979_1049057986 2 Left 1049057979 8:140254177-140254199 CCCTCCTGACTCTGCTCCTGCAG 0: 1
1: 1
2: 6
3: 72
4: 579
Right 1049057986 8:140254202-140254224 ACAGGGTCCCTCAGCCAGGCAGG No data
1049057979_1049057990 15 Left 1049057979 8:140254177-140254199 CCCTCCTGACTCTGCTCCTGCAG 0: 1
1: 1
2: 6
3: 72
4: 579
Right 1049057990 8:140254215-140254237 GCCAGGCAGGTTTCCAGGTGCGG No data
1049057979_1049057992 23 Left 1049057979 8:140254177-140254199 CCCTCCTGACTCTGCTCCTGCAG 0: 1
1: 1
2: 6
3: 72
4: 579
Right 1049057992 8:140254223-140254245 GGTTTCCAGGTGCGGAAAGCAGG No data
1049057979_1049057989 10 Left 1049057979 8:140254177-140254199 CCCTCCTGACTCTGCTCCTGCAG 0: 1
1: 1
2: 6
3: 72
4: 579
Right 1049057989 8:140254210-140254232 CCTCAGCCAGGCAGGTTTCCAGG No data
1049057979_1049057985 -2 Left 1049057979 8:140254177-140254199 CCCTCCTGACTCTGCTCCTGCAG 0: 1
1: 1
2: 6
3: 72
4: 579
Right 1049057985 8:140254198-140254220 AGATACAGGGTCCCTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049057979 Original CRISPR CTGCAGGAGCAGAGTCAGGA GGG (reversed) Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900648840 1:3721235-3721257 CTGCAGGGGCTGGCTCAGGAAGG + Intronic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
902329220 1:15722863-15722885 CTGCAGCAGGCGTGTCAGGAGGG - Intronic
902359772 1:15936005-15936027 GGGCAGGAGCAGGGGCAGGAAGG - Exonic
902381004 1:16052175-16052197 CTGCAAGGGCAGAGTCAGGCAGG - Intronic
903585932 1:24415403-24415425 CAGCAGGAGCAAAGCCCGGAAGG + Intronic
903650184 1:24917251-24917273 CTCCAGGGGCAGGGTCAGCATGG - Intronic
903949183 1:26984724-26984746 ATGCAGGAACAGAGTCAGAGAGG + Intergenic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
904917178 1:33978521-33978543 CTGCAGGGTCAGGGTCAGGAAGG + Intronic
905006566 1:34714621-34714643 CTGCGGAAGGAGAGACAGGAAGG + Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905257219 1:36692597-36692619 CTGTAGGTGGAGAGTCATGAAGG + Intergenic
906647659 1:47487466-47487488 CTGCTGGGGTAGAGTCAGGCAGG - Intergenic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
907487953 1:54789993-54790015 CAGCAGGCGCATAATCAGGAGGG + Intronic
907586261 1:55620650-55620672 CTGCAGGGGCAGAGCCTTGATGG + Intergenic
909245354 1:73274146-73274168 CTGTAGGAGCAGAGGTGGGAAGG + Intergenic
910074479 1:83261222-83261244 TAGCAGGTGCAGAGTCAAGAAGG - Intergenic
910715548 1:90225683-90225705 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
911459664 1:98173590-98173612 CTGCAGGAGCTGACCAAGGAAGG - Intergenic
911848424 1:102783834-102783856 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
914339357 1:146745842-146745864 CTGTAGGGGCAGAGTAAGGCTGG - Intergenic
915015703 1:152731229-152731251 CTTCAGGAAAAGAGTCAGGGTGG + Intergenic
915073827 1:153293223-153293245 CTGTAGGAGGAAAGCCAGGATGG - Intergenic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915600963 1:156923151-156923173 CTGCAGGAGCTGTGCCAGGAGGG - Intronic
915786976 1:158624136-158624158 CTGCAGGGGCAGAGTCCTCATGG + Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916296749 1:163228219-163228241 CTGCAGGGGCAGAGCCATCATGG - Intronic
916315310 1:163442283-163442305 CTCCATAAGGAGAGTCAGGAAGG + Intergenic
916414229 1:164577488-164577510 CTGCTGGAGCCCAGGCAGGAAGG + Intronic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917311775 1:173686115-173686137 CAGCCTGAGGAGAGTCAGGAGGG + Intergenic
919394091 1:197023069-197023091 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
922355262 1:224769254-224769276 ATCCAGGAGCAGAGTCAGAGGGG - Intergenic
922677828 1:227563624-227563646 CTGCAGCAGCAGAGTCACCAGGG - Exonic
922820120 1:228479020-228479042 CTGCAGGGCCAGAGACAGCATGG - Intergenic
923554946 1:234993166-234993188 GGGCAGGAGCAGGTTCAGGAAGG + Intergenic
923575786 1:235157870-235157892 CTTCAGTGGCACAGTCAGGACGG + Intronic
924381676 1:243471166-243471188 CTGGATTAGCAGAGTCGGGATGG + Intronic
924394774 1:243607072-243607094 CTGCAGGGGCAGAGTCCTCATGG + Intronic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1062849061 10:729122-729144 CTGCAGGGGGAGGGTCAGGGAGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064008462 10:11716030-11716052 CTGCAAGGTCAAAGTCAGGACGG + Intergenic
1065320676 10:24506184-24506206 CTGCAGGAACAGATCCAGGTGGG + Intronic
1066317162 10:34259480-34259502 CAGAAGGGGCAGAGTCAGGAAGG - Intronic
1066628456 10:37434015-37434037 CTGGAGGAGCAGTGTGGGGAGGG + Intergenic
1067084165 10:43229435-43229457 GGGCAGGAGCAGAGGCAGGCTGG + Intronic
1067283949 10:44894187-44894209 CAGAAGGAGGGGAGTCAGGAGGG + Intergenic
1067698986 10:48555367-48555389 CTGCGGGAGGAGTGTCACGAAGG + Intronic
1068143903 10:53040885-53040907 CTCCAGGAGTAGAGTGAGGAGGG + Intergenic
1068779093 10:60900078-60900100 CTGCTGGAGCACAGTCGTGAGGG + Intronic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1070004293 10:72408038-72408060 CTGCAAGAGGAGAGACAGCAAGG + Intronic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1071200029 10:83211574-83211596 CTGCAGAATCAGAGTCAGGGTGG + Intergenic
1072725667 10:97811764-97811786 CTGCAGGTGCAGGCTCAGGTGGG + Intergenic
1073094490 10:100971449-100971471 CTGCAGGGGCAGAGCCCTGAGGG - Intronic
1073249641 10:102114023-102114045 CAGCAGGAGTAGAGGCAGCAAGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074147657 10:110730795-110730817 CTGCAAGAGCAAAGTCATGTGGG + Intronic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1075396680 10:122132820-122132842 CTGCAGGAGAAAAGAGAGGAGGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076008131 10:126964444-126964466 CTGTAGGAGCACAGACAGGGAGG + Intronic
1076120412 10:127932579-127932601 CTGCAGCAACAGAGACAGGAGGG + Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1077317685 11:1926672-1926694 CTGCAGAAGCAGCGTCATGGTGG - Intronic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1078016062 11:7616063-7616085 CTGCATGACCAGTGTCAGGAAGG + Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1079237798 11:18702069-18702091 CTGCAGGAGCTGGATCAGGATGG + Exonic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1081315562 11:41625459-41625481 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
1081634581 11:44712296-44712318 CTGCAGCAGCAGTGGCAGGTTGG + Intergenic
1081763577 11:45593762-45593784 CTGCAGGAGAGGAGTGAGCAAGG + Intergenic
1081866926 11:46365292-46365314 CATCAGGAGCAGAGTCAGAAGGG + Intronic
1082003480 11:47407551-47407573 GTACAGGAGAAGATTCAGGAAGG - Intronic
1082794417 11:57369338-57369360 CTGGAGGAGGAGAGGCAGGGCGG - Intronic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083605211 11:63974685-63974707 CAGCAGCAGCGGCGTCAGGACGG - Exonic
1083678598 11:64341197-64341219 GTGCGGGGGCAGAGGCAGGAGGG - Intronic
1083736536 11:64684870-64684892 CTGCAGGAGCCAATGCAGGAAGG + Intronic
1084030310 11:66477059-66477081 ATCCAGGGACAGAGTCAGGATGG + Exonic
1084453619 11:69254628-69254650 CAGCAGGGGCAAAGGCAGGAGGG + Intergenic
1084694306 11:70744621-70744643 CTGCAGGGGCACAGCCAGGTGGG - Intronic
1085120423 11:73964160-73964182 CATCAGGGGCAGAGCCAGGATGG + Intronic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1085560860 11:77472421-77472443 CTGTAAGAGGAGAGACAGGATGG + Intronic
1085607376 11:77914153-77914175 ATTCAGGAGCATAGGCAGGATGG - Intronic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1086220576 11:84438031-84438053 CTGCAGGGGCAGATTCATGGTGG - Intronic
1086332812 11:85770754-85770776 CTGCAGGAGCAGTTTCATGGAGG - Intronic
1087490156 11:98815196-98815218 CTGCATGACAAGAGTCATGAAGG + Intergenic
1089523503 11:119081436-119081458 CTGCAGGAGAAGAGGAGGGAAGG - Intronic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090746082 11:129705738-129705760 CTGCAGGACCCGAACCAGGAGGG + Intergenic
1090804518 11:130194502-130194524 CAGCAGGTGCACAGCCAGGAAGG - Intronic
1090846819 11:130536454-130536476 GGGCTGGAGCGGAGTCAGGAGGG + Intergenic
1091085571 11:132718802-132718824 GTGAAGGAGCAGAGTCTGAAGGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1093235758 12:16606787-16606809 CTGCAGGAGTCGACTGAGGAAGG + Intronic
1094016965 12:25875136-25875158 CTGGAGGAGGCCAGTCAGGATGG - Intergenic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094797931 12:33998085-33998107 CTGAAGGGCCAGAGTCAGCAAGG + Intergenic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096634919 12:52952096-52952118 CTGCAGGGGCACAGAGAGGAGGG - Intronic
1097064377 12:56309997-56310019 CAGCAAGAACAGAGACAGGAAGG - Exonic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1100233475 12:92633742-92633764 CTGCAGGAGCAGTCTCAGGTAGG - Intergenic
1100676046 12:96869508-96869530 CTGCAGGAGCTGAGTCGATATGG + Intronic
1101322923 12:103689132-103689154 CTGCAGGAACAGTTTCAGCATGG - Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102317506 12:111901328-111901350 CTGCAGTAACACAGTCAGGGGGG - Intergenic
1102581344 12:113890238-113890260 CTGCCGGAGCTGAGCCAGGCTGG + Intronic
1102599400 12:114017763-114017785 CTGCAGGATCAGGCTCAGGCTGG + Intergenic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1103610410 12:122120724-122120746 CTTCAGGAGCAGGGGAAGGAGGG + Intronic
1103899393 12:124295469-124295491 CTGAAGGAGCAGGGCCGGGAGGG + Intronic
1103958901 12:124595151-124595173 CTCCAGGCCCAGAGTCAGAAGGG + Intergenic
1104427484 12:128690032-128690054 AGGCAGGTGCAGACTCAGGAAGG + Intronic
1104483657 12:129130409-129130431 AGGGAGGGGCAGAGTCAGGATGG - Intronic
1104497027 12:129250489-129250511 CAGGAGGATCAGAGTTAGGAAGG - Intronic
1104620449 12:130307996-130308018 GAGCAGGAGCAGAGACAGGTCGG + Intergenic
1104655779 12:130572882-130572904 GGGTAGGAGCAGGGTCAGGAGGG + Intronic
1104748697 12:131224878-131224900 CTGGAGGGGCAGAGCCAGGCAGG + Intergenic
1104766563 12:131333754-131333776 CCACAGGTGCAGAGTGAGGAGGG + Intergenic
1104784427 12:131440686-131440708 CTGGAGGGGCAGAGCCAGGCAGG - Intergenic
1104803894 12:131572619-131572641 CTGCAGGAGCAGCGCCAGCCTGG + Intergenic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1105235960 13:18553919-18553941 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1105582915 13:21717909-21717931 CTGCCAGAGCAGAGGCAGGAGGG - Intergenic
1106169090 13:27273228-27273250 CGGCAGGTGCAGACACAGGACGG + Exonic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106462224 13:29981169-29981191 CTGCAGCTGCAGAGGCTGGATGG - Intergenic
1109616221 13:64837251-64837273 CTGCAGGGGCAGAGCCATCATGG + Intergenic
1110531374 13:76602568-76602590 CTGTGGGAGCAGTGACAGGAAGG - Intergenic
1111063816 13:83063463-83063485 CAGCAGCAGCTGAGACAGGAGGG - Intergenic
1111105037 13:83634086-83634108 CAACAGGAGCAGAGTCATAAGGG + Intergenic
1111163164 13:84421467-84421489 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1111227099 13:85288554-85288576 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1111334570 13:86803112-86803134 CTGCAGGGGCAGAGCCTGCATGG - Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1113949496 13:114064205-114064227 CTGCAGGAGCAGAGGCTGCGAGG + Intronic
1114370340 14:22079753-22079775 CTGCAGAAACAGAGTCACTAGGG - Intergenic
1114405262 14:22450428-22450450 CTCCCTGAGCAGAGTCAGAATGG + Intergenic
1114495236 14:23127415-23127437 CTGGAGCAGGAGAGCCAGGAAGG - Intronic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1117873051 14:60220813-60220835 CTACAAGAGCAGAGTGAGGAGGG - Intergenic
1118315444 14:64723094-64723116 TTGCAGGTGCAGAGGCAGGCAGG - Intronic
1119173607 14:72553292-72553314 CTGCTGGCGCAGAGTCAGAATGG + Intronic
1119749711 14:77068467-77068489 CTTCGGGAGCAGTGGCAGGAGGG - Intergenic
1120953004 14:90060330-90060352 CACCAGGAGCAGAGACAGAAGGG - Intergenic
1121551584 14:94806866-94806888 CTCCAGGAGCAAAAGCAGGAAGG + Intergenic
1121618802 14:95332080-95332102 CTCCAGGACCAGAGTCAGTCTGG - Intergenic
1121638326 14:95468630-95468652 AGGAAGGAGCAGGGTCAGGAGGG - Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122274189 14:100582874-100582896 ACGCAGGCGCAGGGTCAGGAGGG - Intronic
1122357836 14:101134637-101134659 GTGCAGGAGCACAGTGAGGTGGG + Intergenic
1122449843 14:101796839-101796861 CTTGAGGAGCAGAGGCAGCAGGG - Intronic
1122928839 14:104924021-104924043 CTGCAGGACACCAGTCAGGAGGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123162028 14:106287655-106287677 CCGCTGGAGCAGCGTCAGAATGG - Intergenic
1124140111 15:27069931-27069953 CAGCATGAGCAGAGACAGAATGG - Intronic
1124596892 15:31098750-31098772 CTGGGGGAGCAGACACAGGATGG + Intronic
1124608812 15:31193510-31193532 CTGGAAGGGCAGAGGCAGGAGGG + Intergenic
1124805172 15:32874486-32874508 CTTCAGGATCACAGTCAGGAAGG + Intronic
1125390431 15:39186618-39186640 CTCCAGGAGCAGAGGAAGAACGG - Intergenic
1125859729 15:42987187-42987209 CGGCAGGGGCAGAGCCGGGATGG + Intronic
1126356587 15:47802431-47802453 CAGCAGCAGCAGAGTCATCAGGG - Intergenic
1126490642 15:49232085-49232107 CTGCAGGAGCAGAGCCGTCATGG - Intronic
1126533240 15:49733181-49733203 CTGCAGGGGCAGAGCCATCATGG - Intergenic
1127028040 15:54829837-54829859 TTGCAGGAGCAAGGTCAAGAAGG - Intergenic
1127263239 15:57341143-57341165 CTGGAGGTGCAGGGACAGGAAGG + Intergenic
1127268146 15:57377254-57377276 CGGCATAAGCAGAGTCGGGAGGG - Intronic
1127618574 15:60711069-60711091 CTGCAGGGGCAGAGCAAGGCTGG - Intronic
1128132494 15:65238332-65238354 CTCCAGGAGAAGGGTCTGGATGG - Intronic
1128346024 15:66852850-66852872 CTGCAGTATAGGAGTCAGGATGG + Intergenic
1128700079 15:69797560-69797582 CTGCAGGAGCAATTTCAGGTGGG - Intergenic
1128715307 15:69903510-69903532 CAGCAGTAGCAGGGCCAGGAAGG + Intergenic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1128916523 15:71567656-71567678 CTTCAGGAGCTGAGAGAGGAAGG + Intronic
1129172319 15:73815792-73815814 CTGGAGGAGCAGGGGCAGAAAGG - Intergenic
1129239467 15:74242932-74242954 GTGCAGGAGTGGAGTCAGGGAGG - Intronic
1129389760 15:75214668-75214690 GTGCAGCAGGAGAGACAGGAGGG - Intergenic
1129701654 15:77771854-77771876 TGCCAGGACCAGAGTCAGGAAGG - Intronic
1130305976 15:82712232-82712254 CTTCAGGAGCAGTGGCAAGATGG - Intergenic
1131065656 15:89433562-89433584 CTGCAGCTTCAGAGTCTGGAGGG + Intergenic
1131312560 15:91304207-91304229 CTGCAGGAGGAGAGAGAGGGGGG + Intergenic
1131427043 15:92354280-92354302 CTGCAGGGGCAGAGTCTTCATGG + Intergenic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132508075 16:322468-322490 GTGCAGGAGCTGAGTTAGCATGG + Intronic
1132771338 16:1565128-1565150 CGGCAGGCGCAGAGTCGAGAGGG + Intronic
1133816252 16:9199533-9199555 CTCCTGGGGCAGAGGCAGGAAGG - Intergenic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1134809629 16:17156494-17156516 CTGCAGGAGCAAAGTGGGGCTGG - Intronic
1135011998 16:18889553-18889575 CTTCAGGAGTTGAGACAGGAGGG - Exonic
1135318854 16:21476780-21476802 CTTCAGGAGTTGAGACAGGAGGG - Intergenic
1135371749 16:21908573-21908595 CTTCAGGAGTTGAGACAGGAGGG - Intergenic
1135380376 16:21991341-21991363 CTCCAGGGGCTGAGGCAGGAGGG - Intronic
1135440038 16:22462131-22462153 CTTCAGGAGTTGAGACAGGAGGG + Intergenic
1135510063 16:23074939-23074961 ATGCTGGAACAGACTCAGGATGG + Intronic
1136329158 16:29558846-29558868 CTTCAGGAGTTGAGACAGGAGGG - Intergenic
1136443789 16:30298558-30298580 CTTCAGGAGTTGAGACAGGAGGG - Intergenic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1136849882 16:33604167-33604189 CTGCATGAGCAGACTCTGAAGGG - Intergenic
1137975878 16:53031581-53031603 CTGCAGGAGAGGAGAGAGGAAGG + Intergenic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1138347100 16:56326746-56326768 CTCCATGGGCAGAGGCAGGAGGG + Intronic
1138552739 16:57756376-57756398 CTGCAGGATCAGCTTCAGGGAGG - Exonic
1139820493 16:69717319-69717341 CTGCAGGAACACATTCAGCAGGG + Intronic
1139994918 16:70971507-70971529 CTGTAGGGGCAGAGTAAGGCTGG + Intronic
1141216733 16:82032206-82032228 CTGCAGGAGCAGAGACTAGTGGG - Intergenic
1141545078 16:84761456-84761478 CATGCGGAGCAGAGTCAGGAAGG + Intronic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1203111493 16_KI270728v1_random:1452620-1452642 CTGCATGAGCAGACTCTGAAGGG - Intergenic
1142521224 17:506152-506174 CTTCGAGAGCAGGGTCAGGACGG + Intergenic
1142521306 17:506802-506824 CTTCGAGAGCAGGGTCAGGACGG + Intergenic
1142567587 17:850647-850669 CCCCGGGAGCTGAGTCAGGAGGG + Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1143857504 17:9863096-9863118 CTGCAGGTCCAGTGACAGGAGGG - Intronic
1144605175 17:16658423-16658445 CTGCAGGGGCAGAGTCCTCACGG - Intergenic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1145019249 17:19416749-19416771 CTGCTGGAGCAGATTTGGGAAGG - Exonic
1145772024 17:27500113-27500135 CTGGGGGAGCTGAGCCAGGATGG + Intronic
1145898630 17:28475341-28475363 AGACAGGACCAGAGTCAGGATGG - Intronic
1146622620 17:34411350-34411372 CTCCTGGAGCCTAGTCAGGAAGG - Intergenic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1150293062 17:63992969-63992991 TGGCAGGGGCAGAGTCAGGAGGG + Intergenic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1151488535 17:74417819-74417841 CTGCAGGAGGGGTGTTAGGAAGG + Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1152317826 17:79591115-79591137 GTCCAGGAGAAGAGCCAGGATGG + Intergenic
1152667949 17:81582199-81582221 CTGCAGCAGCACAACCAGGAGGG + Intronic
1152725036 17:81941016-81941038 GTACAGGAGCACAGCCAGGAAGG + Exonic
1153227496 18:2909671-2909693 CTCCTGGAGCAGAGAAAGGATGG - Exonic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1154513584 18:15136079-15136101 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
1156243610 18:35276713-35276735 CTGCAGGGGCAGAGTCCTCATGG + Intronic
1157891565 18:51423126-51423148 GAGCAGGAGCAGAGTCCAGAAGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158504962 18:58039304-58039326 CTCAAGGAGCTGAGGCAGGAGGG - Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159583423 18:70260749-70260771 CTGCAGGTCCACAGGCAGGAAGG + Intergenic
1160242491 18:77133203-77133225 CTGCAGGAGGAGAGTCAGCCCGG + Intronic
1160258246 18:77265609-77265631 CTGCAGGGGCAGAGTCCTTATGG - Intronic
1160505639 18:79425402-79425424 CCACAGGAGCAGCTTCAGGAGGG - Intronic
1160565932 18:79786580-79786602 CTGCTGGGGCAGGGCCAGGACGG + Intergenic
1160718267 19:586145-586167 CTGCAGGAGCACAGCCCTGAGGG - Intergenic
1160719682 19:591716-591738 CTGGAGGAGGAGAGACAGGCGGG - Intronic
1161062089 19:2220245-2220267 CAGCAGCAGCAGAGTCCTGAGGG - Intronic
1161139973 19:2641434-2641456 CCTCAGGAGAAGAGGCAGGAGGG + Intronic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161346804 19:3772243-3772265 CTGCCGGAGCCGAGCCAGGTCGG + Intergenic
1161508721 19:4658488-4658510 CTGCTGGAGAAGTGTCATGAGGG - Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1163442956 19:17330745-17330767 CTGCAGGAGCAAAGGCAGAGAGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1167285900 19:48598901-48598923 CTGCAGTAGCAGAGGCAGTGAGG + Intronic
1167382941 19:49149125-49149147 CTGCAGGAGCAAGGCCAGGTCGG - Exonic
1167410415 19:49340804-49340826 GTGCAGGAGCAGAGCCAGGTGGG - Exonic
1167430121 19:49449373-49449395 CTCCAGGAGCTGAGGGAGGAGGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925237646 2:2293456-2293478 CTGCAGGAGCAGGGCGTGGAGGG + Intronic
925933152 2:8727184-8727206 CAGCATGAGCAGACTCAGGTGGG - Intronic
925991271 2:9256908-9256930 CTGCAGCAGGAGGATCAGGAAGG - Intronic
927057729 2:19382477-19382499 GAGCAGGAGCATTGTCAGGATGG + Intergenic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
927478533 2:23432729-23432751 GTGCAGGTGCTGAGGCAGGAGGG + Intronic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
927635913 2:24816659-24816681 CTGCAAGGGCCCAGTCAGGAGGG - Exonic
927841665 2:26448933-26448955 CCTGAGGAGCAGAGTCAGGATGG + Intronic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
928189068 2:29144908-29144930 CTACAGGGGCTGAGGCAGGAGGG - Intronic
928312319 2:30221144-30221166 CTGGAAGAACAGAGTCAAGAGGG - Intergenic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
930060252 2:47282594-47282616 CTGTAGGAGTTCAGTCAGGATGG + Intergenic
930438489 2:51377230-51377252 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
930705778 2:54503399-54503421 CTGCAGGAGAACAGACAGGTAGG - Intronic
931000756 2:57779496-57779518 CTGCAGAAGAACAGTAAGGATGG - Intergenic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
933767287 2:85718885-85718907 GTACAGGAGCAGATTCAGGGAGG - Intergenic
934087316 2:88520678-88520700 CTGCTGCAGCAGAGCCAGGAGGG - Intergenic
935155294 2:100479070-100479092 CTCCAGGAGCAGAGTGCTGAGGG + Intronic
935625438 2:105168782-105168804 CTGCAGGACCACATTCAAGAAGG + Intergenic
936044035 2:109172377-109172399 CTCCAGGAGCAGGGAGAGGACGG - Intronic
937106943 2:119324717-119324739 CTGCAGGAGGGGAGTCGAGAGGG - Intronic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
938060476 2:128250748-128250770 CCCCAGGAGCAGACTCAGCAAGG + Intronic
938064267 2:128272593-128272615 CTGCAGGGGCAGTGTCTTGAGGG + Intronic
938513824 2:131980690-131980712 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939376860 2:141379958-141379980 CTTCAGGAGCAGGCTGAGGAAGG - Intronic
941013216 2:160325015-160325037 ACTCAGGAGCAGAGTCAGTAAGG + Intronic
943006539 2:182393106-182393128 CTGCAGGGGCAGAGTCCTTATGG - Intronic
944197593 2:197071934-197071956 CCGCAGGAGGGAAGTCAGGAAGG - Intronic
944495009 2:200298306-200298328 CTGCAGAAGACAAGTCAGGAGGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945984083 2:216340397-216340419 CTGCAGGAGGAGAGCCAGGGAGG - Intronic
946721691 2:222615568-222615590 ATGTAGGAGCAGAGTAAGCATGG - Intronic
946884361 2:224208339-224208361 CTGCTGGAGCAGTGTGAGCAAGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947464257 2:230326958-230326980 CTGCAGGACCAGGGAAAGGAGGG - Intergenic
948187804 2:236035037-236035059 CTGCAGGCGCATTGTGAGGAAGG + Intronic
948386123 2:237582107-237582129 AGGCAGGAGCAGAGGCAGAACGG - Intronic
949044269 2:241863777-241863799 CTGCAGAAGCAGTTTCGGGATGG - Intergenic
1169427210 20:5505775-5505797 CTTAAGGAGCTGAGACAGGAGGG - Intergenic
1169794186 20:9443620-9443642 CTGCAGGATCAGACTGAGGCTGG + Intronic
1169900224 20:10545199-10545221 CTGAACTAGCAGAGCCAGGATGG + Intronic
1169952768 20:11064352-11064374 CTGTAGGACCTGAGTCAGGGAGG - Intergenic
1170842222 20:19933295-19933317 GTGCAGGAGGAGAGGCAGGCAGG - Intronic
1171181204 20:23092039-23092061 TTGCGGGAGTAGAGTCAGGGTGG - Intergenic
1171399119 20:24860310-24860332 GTGCAGGAGCTGGGTCACGAGGG - Intergenic
1171449143 20:25224055-25224077 CTGCAGGAGCACTGTGAGGTTGG - Intronic
1171519735 20:25766571-25766593 CTGCAGGAGCCCAGTCAGAAGGG - Intronic
1171557185 20:26089922-26089944 CTGCAGGAGCCCAGTCAGAAGGG + Intergenic
1171877708 20:30593827-30593849 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1172070270 20:32251649-32251671 CTTCAGCAGCAGAGACAGGGAGG + Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1173274335 20:41566502-41566524 CCACAGGAGCAGAGTGGGGAAGG - Intronic
1175234669 20:57501754-57501776 CTGCTGGTGCAGAGTCAGTGAGG + Intronic
1175459573 20:59142214-59142236 ATGAAGGAGCAGAGCCATGAAGG + Intergenic
1175940631 20:62536036-62536058 CTCCAGAAGCAGAGTTGGGAGGG - Intergenic
1175955497 20:62606966-62606988 CTGCAGGTGCAGAGTCCCCAGGG - Intergenic
1176057323 20:63155593-63155615 CAGCAGGAGCAGGCTCAGGACGG + Intergenic
1176112580 20:63417332-63417354 CTGCCTGAGCGGGGTCAGGAGGG - Intronic
1176653876 21:9572855-9572877 CTGCAGGAGCCCAGTCAGATGGG - Intergenic
1176701157 21:10052074-10052096 CTGCAGGAGAAAAGTTTGGATGG + Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1177807499 21:25888648-25888670 TTGCAGGAGCAAAATCGGGAAGG - Intronic
1177977611 21:27871231-27871253 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1179271944 21:39858350-39858372 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
1179461415 21:41537980-41538002 CTGCAGAAGCAGAGACAGACGGG - Intergenic
1179629053 21:42665579-42665601 CTGTAGGAGCAGAGCAAGGTCGG - Intronic
1179779566 21:43690617-43690639 CTGAGGGATCACAGTCAGGAAGG + Intronic
1179936425 21:44608038-44608060 TTCCTGGGGCAGAGTCAGGAGGG + Intronic
1180054014 21:45347867-45347889 CTGCAGCAGCACAGGCTGGAGGG + Intergenic
1180245818 21:46546614-46546636 CTGCTGGGGCAGCGTCAGCATGG - Intronic
1180709660 22:17831202-17831224 CTGCTGGAGCAGAGAAAGAATGG + Intronic
1180926120 22:19556165-19556187 CTGCAGGGCCAGAGGCAAGATGG - Intergenic
1181018643 22:20086344-20086366 CTGCAGGAGTAAGGACAGGAAGG + Exonic
1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181468041 22:23120762-23120784 CTGCAGGAATAGAGCCAGGCAGG - Intronic
1182325673 22:29510995-29511017 CTGCAGGGGAAGTTTCAGGAAGG + Intronic
1182510108 22:30813589-30813611 CTGCAGCAGCTGGGTGAGGATGG - Intronic
1182518864 22:30873934-30873956 CTTCAGGAGAAAAGTCAGGGTGG + Intronic
1182786397 22:32911431-32911453 AGGCAGGAGAAGAGTCAAGATGG - Intronic
1183249893 22:36723000-36723022 CTGCAGGGGCAGAGGCATGGAGG - Intergenic
1183279078 22:36922620-36922642 CTGCAGGAGCAAAGTCCCGGAGG - Intronic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183928308 22:41221486-41221508 CAGTAGGAGCAGAGTCTGGGTGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184098502 22:42329439-42329461 ATTCAGGAGCAAAGTAAGGAGGG + Intronic
1184115480 22:42419343-42419365 CTGCTGGAGGAGACCCAGGAAGG + Intronic
1184209158 22:43025090-43025112 CTGCTGGAGGAGCGGCAGGAGGG - Intergenic
1184383359 22:44160350-44160372 CAGCAAGGGCAGAGCCAGGAGGG + Intronic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1184712950 22:46263550-46263572 GTGCAGGCCCAGGGTCAGGATGG + Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185276996 22:49954081-49954103 CCGCAGGAGGAGAGTGTGGAAGG + Intergenic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
949147885 3:725565-725587 CTGCAAGGGCAGAGTGAAGAGGG - Intergenic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950126198 3:10511207-10511229 CTGCTGGAGCTGAGTCTTGAAGG - Intronic
950436530 3:12983627-12983649 CTGAAGGAGCTGAGCCAAGAAGG - Intronic
950494282 3:13324376-13324398 CGGCAGGAGCACTGTGAGGAAGG - Intronic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
951580100 3:24153610-24153632 CTGAAGGAGCAAAGACAGGAGGG - Intronic
952333694 3:32387021-32387043 CCACAGGAGCTGAGTGAGGAAGG - Intergenic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
953108765 3:39911863-39911885 CTTCAGAAGCTGAGTAAGGAGGG - Intronic
958055040 3:88399421-88399443 ATGCAGGAGCAGAGTGAGTGAGG - Intergenic
959183170 3:103007870-103007892 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
961052016 3:123755061-123755083 CTGTATGAGCAGAGTCCTGAGGG - Intronic
961128775 3:124446161-124446183 CTGCAGGAGCTCACTCAGGATGG - Exonic
961319712 3:126064220-126064242 CCACAGGAGCAGAGTCAGGAGGG - Intronic
961811235 3:129523100-129523122 CTGCAGGGGGAGAATCAGGGAGG - Intergenic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
962020581 3:131496974-131496996 CTGCAGAAGCAGAGACAACATGG - Intronic
962201325 3:133403327-133403349 CTGCAGGTGGAGAAACAGGAGGG - Intronic
962264818 3:133937345-133937367 CAGCAGGAGCAGGGTCTGAAGGG + Intronic
962298377 3:134214583-134214605 CAGCAGGAGTAGAGTAAGAAGGG - Intronic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
964974877 3:162606313-162606335 CTGCAGGGGCAGAGCCATCATGG + Intergenic
965395045 3:168152882-168152904 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
967509411 3:190292156-190292178 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
967855577 3:194115060-194115082 CTGCAGGAACAGAGCCAGTCTGG - Intergenic
968376717 4:50078-50100 CTGCAGGAGGAGAGCCTGCAGGG - Intergenic
968546361 4:1200936-1200958 CTGCTGCAACAGAGCCAGGAGGG - Intronic
968961953 4:3750171-3750193 CTGCAGCAGCAGGGACAGAAGGG + Intergenic
968971571 4:3798329-3798351 CTGGTGGGGCAGAGTCAGGGTGG + Intergenic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
970577714 4:17444132-17444154 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
971499233 4:27300587-27300609 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
973576251 4:52292335-52292357 CAGCAGGAGCAGAGTCACTAGGG - Intergenic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
975174416 4:71270965-71270987 CTGGAAGAGAAGAGGCAGGATGG - Intronic
975363899 4:73505449-73505471 CTGAAGGTGCAGAGTGAGAAAGG + Intergenic
975627005 4:76360265-76360287 CTGCAGGAGCAGAGCCCTCATGG + Intronic
975765912 4:77667401-77667423 CTGCAGGAGTGGAGACTGGAAGG - Intergenic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
977848006 4:101789300-101789322 ATTGTGGAGCAGAGTCAGGATGG + Intronic
978721745 4:111918015-111918037 ATGCAGTGGCAGAGCCAGGAAGG - Intergenic
978983690 4:114983102-114983124 CTGCAGGAGCAGAGCCCTCATGG + Intronic
980586023 4:134817093-134817115 CTGCAGGGGCAGAGTCTTCATGG - Intergenic
981275419 4:142893523-142893545 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
982068496 4:151674918-151674940 CTGCAGACGCAGACCCAGGAGGG - Intronic
982113784 4:152080033-152080055 CTGCAGCAGCACAGTCAGCATGG - Intergenic
982209083 4:153020496-153020518 GTGCAGGAGGAGAGTGGGGAAGG - Intergenic
982258271 4:153470903-153470925 CTGCAGGGCAGGAGTCAGGAAGG - Intronic
982478349 4:155879053-155879075 CTGCAGGGGCAGAGTCCTCATGG - Intronic
982650431 4:158081662-158081684 CTGCAGGAGCAGCTGCAGGCAGG - Intergenic
982900916 4:161002527-161002549 ATCCAGGTGCAGAGTGAGGAGGG + Intergenic
983510821 4:168607948-168607970 CTGCAGGAACAGAGTAAGATTGG - Intronic
983766442 4:171490011-171490033 TTGCAGGAGCACAGGCAGAAAGG + Intergenic
984766583 4:183404748-183404770 CTGCAGGAGCCCAGGCAGGAAGG + Intergenic
985061277 4:186081836-186081858 CTGCAGGAACCGAGTAAGGAAGG + Intronic
985220320 4:187697079-187697101 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
985849664 5:2379310-2379332 CTGCAGGAGAAGAGCCCTGAAGG - Intergenic
986181839 5:5400356-5400378 CTGCAGTAGCAATGTCAGGTTGG + Intergenic
986184457 5:5422837-5422859 CGGCATCAGCAGAGACAGGACGG + Exonic
986805527 5:11305281-11305303 TGTCAGGAGCAGAGTCAGAATGG + Intronic
988001259 5:25352047-25352069 CTACAGGAGAGGAGTCAGGAAGG - Intergenic
988464282 5:31473559-31473581 CTGCAGTAGAAGCTTCAGGAAGG - Intronic
988623026 5:32842861-32842883 CTGCAGGAATCTAGTCAGGAAGG + Intergenic
989027699 5:37086385-37086407 CTGCAGGGGTTCAGTCAGGATGG + Intergenic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992504719 5:77375615-77375637 CTGCAGGAGGACATTAAGGAGGG - Intronic
993015398 5:82530100-82530122 CTGCAGGAAAAGAGAAAGGAGGG - Intergenic
993139127 5:84008146-84008168 TTGCAGGAGTAAAGTGAGGATGG + Intronic
994051763 5:95369989-95370011 CTGAAGGGGAGGAGTCAGGAAGG - Intergenic
995008358 5:107229214-107229236 ATGCAGGGACAGAGACAGGAGGG - Intergenic
995617043 5:113976459-113976481 CTGTTAGAGCAGAGCCAGGATGG + Intergenic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
996126149 5:119727676-119727698 CTGCAGGGGCAGAGTCCTAATGG + Intergenic
996286186 5:121795756-121795778 CTGCAGGAGCACAGTGGGGGAGG + Intergenic
996487510 5:124054398-124054420 GTGCAGGAGTAGAGTCTAGAAGG + Intergenic
996698470 5:126424124-126424146 CTTCAAGAGCAGAGTGGGGATGG + Intronic
996774732 5:127121115-127121137 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
997091554 5:130864497-130864519 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
997102064 5:130980463-130980485 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
997108227 5:131045843-131045865 CTGCAGGGGCAGGGTCATCATGG - Intergenic
997232417 5:132254454-132254476 CTCCAGGAGCTGAGCCAGAATGG + Intronic
997415669 5:133726479-133726501 CTTCTGGAGGAGAGTGAGGATGG - Intergenic
997529674 5:134574091-134574113 CTGCTGGTGCTGAGGCAGGAAGG + Intronic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
997846495 5:137291221-137291243 CTGGAGGAGCAGAGCCACCAGGG + Intronic
998745865 5:145259183-145259205 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
999380358 5:151117164-151117186 CTGCAGGGGCATCGTGAGGAGGG - Exonic
999383164 5:151136000-151136022 CTGCAGAAGCAATGGCAGGAAGG + Intronic
1000029428 5:157389460-157389482 TTGCAGGAGCACAGGCAGGTTGG - Intronic
1001708134 5:173756856-173756878 CTGCATTACCAGAGTCAGGTGGG - Intergenic
1001855332 5:175005507-175005529 CAGCAGGAGCGGAGTCAGGCAGG + Intergenic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002272793 5:178083733-178083755 CTGCAGGTGCCGAGACAGGGAGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004069782 6:12288053-12288075 CTGCAGGGGCAGCCTCAGCAAGG + Intergenic
1004275814 6:14234180-14234202 CCACAGAAGCAGAGGCAGGAAGG + Intergenic
1004403503 6:15310644-15310666 CTGCAGGTGCAGAGATGGGATGG + Intronic
1004588860 6:17029590-17029612 GTGAAGGTGCAGAGTCAGTAAGG - Intergenic
1005134852 6:22556318-22556340 CTGCTGGAGTAGAGGAAGGATGG - Intergenic
1005499598 6:26418256-26418278 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1006102103 6:31691828-31691850 CTGCAGCAGCACAGGCATGAGGG + Exonic
1006449560 6:34098405-34098427 CAGAAAGAGCAGAGTCAGCAAGG - Intronic
1006589774 6:35146010-35146032 CTGAAGGATGAGAGTCAGGGAGG - Intronic
1007381697 6:41494288-41494310 CAGTAGGGGCAGACTCAGGAAGG + Intergenic
1008507624 6:52246399-52246421 CTGGGGCAGCAGAGCCAGGACGG + Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008793349 6:55267849-55267871 TTGCAGGGGCAGAATCAGGAAGG + Intronic
1009242467 6:61198874-61198896 CTGCAGGAGCAGAGTCCTCATGG + Intergenic
1010360463 6:74987265-74987287 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1010415903 6:75611161-75611183 CCACAGAAGCAGAGTCAGCAGGG - Intronic
1011783879 6:90822021-90822043 TCTCAGGAGCAGAGTCAGAATGG - Intergenic
1012758506 6:103264278-103264300 CTGCAGGAGCGAAGTCTGGGAGG - Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013716390 6:112967884-112967906 CTGCAGAAGCAGAGCCCTGATGG - Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014895219 6:126892894-126892916 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1015386795 6:132633750-132633772 CTGCAGGAGCAAAAACAGAAAGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1016108193 6:140188619-140188641 CTGCAGGAGCAGGGTCCTCAGGG + Intergenic
1018169235 6:161131315-161131337 CTGCAGGAGCTGAGGAAGGAAGG + Exonic
1018377841 6:163230766-163230788 CTGTAGGTGCAGAGTTAGGGAGG + Intronic
1018385638 6:163300477-163300499 CTGCAGGAAGAGAGTGAGGGCGG - Intronic
1018581639 6:165313008-165313030 GGGCAGGGGCAGAGTCCGGAGGG + Intergenic
1018683199 6:166281859-166281881 CCCCAGGTGCAGAGGCAGGAGGG - Intergenic
1018755032 6:166841645-166841667 CTGCAGAGGCTGAGTCAGAAAGG + Intronic
1018818721 6:167356215-167356237 CTCCACGCGCAGAGACAGGAGGG + Intronic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019448708 7:1084848-1084870 CTGCAGGAGCAGAGCCCTCAGGG - Intronic
1020133766 7:5574612-5574634 TTGCTGGAGCAGAGCCAGGTGGG - Intergenic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1023105193 7:36756888-36756910 CAGCAGGAGAAAAGTCTGGAGGG + Intergenic
1023188529 7:37555399-37555421 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1024541583 7:50479520-50479542 TTGCAGGAGCAGGGGCAGGTGGG - Intronic
1025895847 7:65699788-65699810 ATTCAGGAGCACAGGCAGGATGG + Intergenic
1026946746 7:74321049-74321071 CAGCAGGAGCAGGGCTAGGAGGG - Intronic
1027292178 7:76726088-76726110 TAGCAGGTGCAGAGTCAAGAAGG - Intergenic
1027800924 7:82747850-82747872 CTGGAGGATCAGAGACAAGAAGG + Intergenic
1029111894 7:98217019-98217041 CTGGGGCAGCAGAGCCAGGATGG - Exonic
1029599935 7:101557681-101557703 CTCCAGGGGCAGGGTCTGGAGGG + Exonic
1029704173 7:102267116-102267138 CTACAGGTGCAGAGGCAGGGAGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031583456 7:123505404-123505426 CTGCAGGAGCAGAGCCCTCATGG - Intronic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1033210810 7:139458936-139458958 CTGCAGGTGCTGAGGCAGGGTGG - Intronic
1033407886 7:141088328-141088350 TTTCAGGAGCAGTCTCAGGAGGG - Intronic
1034427692 7:151023300-151023322 CAGCAGGGGCAGGGTCAGGGAGG - Intronic
1034970026 7:155413089-155413111 CTCCAGCAGCAGGGTGAGGAAGG + Intergenic
1035236934 7:157503405-157503427 CTCCAGGAGCAGAGGCTGCAAGG + Intergenic
1035681114 8:1488829-1488851 CTGCAGGACAAGAGTCAGCCTGG - Intergenic
1036454940 8:8898258-8898280 CTGCAAGAGCAGAGTCATTCAGG + Intergenic
1037290527 8:17345223-17345245 CTGCAGGAGCAGAGCGTGGCAGG - Intronic
1037455894 8:19063736-19063758 CTGAAGGTGCATAGTCAGAAAGG + Intronic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038684320 8:29702600-29702622 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1039811779 8:41055320-41055342 CTGAAAGAGCAGGGTCAGGAGGG + Intergenic
1040391578 8:46954948-46954970 CTGCAGGAGGAGGGTGAGGCCGG + Intergenic
1040801678 8:51349226-51349248 AGGCAGGAGCAGCGTCAGGGTGG - Intronic
1042432792 8:68727576-68727598 CTGCAGGAGCAGGGCCTGTATGG - Intronic
1042802228 8:72732025-72732047 CTGAAGGAGGAGATTCAGCAGGG - Intronic
1043065718 8:75567814-75567836 CTGCCGGAGCAGAGCCCGCATGG - Intergenic
1043704382 8:83330306-83330328 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1046805840 8:118478058-118478080 CTAGAGGTGCAGAGTCAGGCAGG - Intronic
1047920678 8:129631445-129631467 CTACAGGAGCACAGATAGGAGGG - Intergenic
1047981822 8:130191332-130191354 CTGCAGGAGCAGATTATAGATGG + Intronic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048685551 8:136901215-136901237 CTGCAGGAGCACCATCAAGATGG + Intergenic
1048764882 8:137833076-137833098 CTAGAATAGCAGAGTCAGGAAGG + Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049072657 8:140368736-140368758 TAGCAGGAGGAGAGTCAGGCGGG - Intronic
1049397800 8:142409671-142409693 CTGCAGAGGCAGGGCCAGGAGGG - Intergenic
1049414256 8:142488156-142488178 GTCCAGGAGCAGAGACAGCAAGG - Intronic
1049654016 8:143789848-143789870 CTTCGGGAGCAGACGCAGGAGGG + Intergenic
1049764906 8:144350627-144350649 CTGCAGGAACAGCCTCAAGAAGG - Intergenic
1049953013 9:663729-663751 CAGCTGGAGCAGAGCCAGCACGG + Intronic
1050109524 9:2200299-2200321 CTGCAGGAGCAGAGCCCTTATGG - Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1051356062 9:16240601-16240623 CTGCTGGAGCAAAACCAGGAAGG + Intronic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053395172 9:37766960-37766982 CTACGGGAGCAGAGTTGGGAGGG + Intronic
1053638300 9:40038573-40038595 CTGCAGGAGAAAAGTTTGGATGG + Intergenic
1053767784 9:41426647-41426669 CTGCAGGAGAAAAGTTTGGATGG - Intergenic
1054319093 9:63635172-63635194 CTGCAGGAGAAAAGTTTGGATGG + Intergenic
1054546450 9:66338151-66338173 CTGCAGGAGAAAAGTTTGGATGG - Intergenic
1055332861 9:75202131-75202153 CTACAGAATCAGAGTCTGGAGGG + Intergenic
1055798863 9:80009097-80009119 CTGCAGTAGCAGAAACACGATGG + Intergenic
1055829078 9:80359060-80359082 CTGCAGGTGCGGAGACAGCAAGG + Intergenic
1056815052 9:89795114-89795136 GAGCAGGAGCAGAGCCAGGACGG - Intergenic
1056965628 9:91161121-91161143 TGGCAGGCGCAGAGGCAGGAAGG - Intergenic
1057241044 9:93409556-93409578 CAGCAGGAGGAAAGTGAGGATGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057318801 9:93992644-93992666 CTGGAGGAGAAGGGACAGGAGGG - Intergenic
1057572719 9:96216582-96216604 CTGCAGGCGGGGAGCCAGGAGGG + Intergenic
1057846161 9:98526329-98526351 GTGCTGGAGCAATGTCAGGAAGG - Intronic
1058288559 9:103209919-103209941 CTGCATGAGCAGAGCCATCATGG - Intergenic
1058627442 9:106949872-106949894 CAGCTGGAGGACAGTCAGGAAGG - Intronic
1059457787 9:114410674-114410696 CTTCAGGGGCATAGTCAGGCAGG + Intronic
1060198938 9:121640622-121640644 GTTCAGCATCAGAGTCAGGAGGG + Intronic
1060217301 9:121746078-121746100 CTGTGGGGGGAGAGTCAGGAAGG + Intronic
1060934237 9:127506383-127506405 CGGAAGGAGCAGGGCCAGGAGGG + Exonic
1061298209 9:129688588-129688610 CTGAAGGAGAACAGCCAGGAGGG + Intronic
1061387488 9:130299115-130299137 CTTCGTGGGCAGAGTCAGGAGGG - Intronic
1061483055 9:130906596-130906618 CAGCAGCAGGAGAGTCAGGGAGG - Intronic
1061524703 9:131149777-131149799 GGGCAGGGGTAGAGTCAGGAAGG - Intronic
1061738401 9:132679525-132679547 CTGCAGGAGAGGAGCAAGGAAGG + Exonic
1061787095 9:133036041-133036063 TTGCAGAAGGAGGGTCAGGAAGG - Intronic
1061935529 9:133855486-133855508 CTGCAGGAGCAGAGGCTAAAAGG + Intronic
1061974470 9:134061403-134061425 CTGGAGGAGCAGTGGCAGGGAGG + Intronic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062336972 9:136075617-136075639 CTGCGGGAGCAGAGCCTGCAGGG + Intronic
1062396853 9:136356056-136356078 CTGCAGGGGCAGTCTCAGGGAGG + Intronic
1062418327 9:136465595-136465617 CTGCAGGAGCGGAGTCTCCAAGG + Intronic
1062517913 9:136945343-136945365 TGCCAGGAGCAGAGTCAAGAGGG - Exonic
1062707987 9:137955739-137955761 CTGCCGGCGCAGCTTCAGGAAGG - Exonic
1202786173 9_KI270719v1_random:22129-22151 CTGCAGGAGAAAAGTTTGGATGG + Intergenic
1203492339 Un_GL000224v1:118981-119003 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1203504962 Un_KI270741v1:60853-60875 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1203572513 Un_KI270744v1:144168-144190 CTGCAGGAGGAGAGCCTGCAGGG + Intergenic
1203631597 Un_KI270750v1:76307-76329 CTGCAGGAGCCCAGTCAGATGGG - Intergenic
1185663538 X:1745988-1746010 CTGTAGGAGCAGAGACATGTCGG + Intergenic
1185713026 X:2319245-2319267 CTGCAGGAGTAGGGAGAGGAGGG - Intronic
1186279044 X:7972871-7972893 CTCCAGGAGCAGAGTCTTTAAGG - Intergenic
1186454629 X:9701408-9701430 CTGCAGGAGCTGACTCAGAGTGG + Intronic
1187276222 X:17818427-17818449 CTCCAGTAGCAGCCTCAGGATGG - Intronic
1187603773 X:20861559-20861581 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188975550 X:36669760-36669782 CTGAAGGAGCTGGGTCAGGCAGG - Intergenic
1189228779 X:39435672-39435694 CTGCAGGAGCAGGGTCCTCACGG - Intergenic
1189652777 X:43208228-43208250 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1191873348 X:65769208-65769230 CTGCAGGAGCAGAGACCTCATGG + Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1192955314 X:76063845-76063867 CTGCAGGAGCAGAGCCGTCATGG - Intergenic
1193593994 X:83423300-83423322 CTGCAGGAGCAGAGCCCTCATGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194014183 X:88599089-88599111 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1194084583 X:89510068-89510090 CTGCAGGGGCAGAGTCCTAATGG - Intergenic
1194886130 X:99318348-99318370 CTGCAGGAGCAGAGCCATCATGG + Intergenic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1196906754 X:120444541-120444563 CGGCTGGAGGAGAGTCAGGAAGG - Intronic
1197252001 X:124226414-124226436 CTGCAGGTTCAAATTCAGGAAGG + Intronic
1197415378 X:126166435-126166457 CTGCAGGGGCAGAGTCGCGGAGG + Intergenic
1197473401 X:126890858-126890880 CTGCAGGGGCAGAGTCCTCAAGG - Intergenic
1198775291 X:140172879-140172901 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1199220526 X:145311084-145311106 CTGCAGGAGCAGAGCCCTCATGG - Intergenic
1199424022 X:147680435-147680457 CTGCAGGAGCAGAGTAGGGAGGG + Intergenic
1200232819 X:154452914-154452936 CTTCAGCTGCAGAGTCAGCATGG + Intergenic