ID: 1049059056

View in Genome Browser
Species Human (GRCh38)
Location 8:140261875-140261897
Sequence CCTGCCCAACACAACCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049059050_1049059056 30 Left 1049059050 8:140261822-140261844 CCCAGATCAGGAGGAGTGGCTTG 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1049059056 8:140261875-140261897 CCTGCCCAACACAACCTGGAAGG No data
1049059051_1049059056 29 Left 1049059051 8:140261823-140261845 CCAGATCAGGAGGAGTGGCTTGT 0: 1
1: 0
2: 0
3: 19
4: 131
Right 1049059056 8:140261875-140261897 CCTGCCCAACACAACCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049059056 Original CRISPR CCTGCCCAACACAACCTGGA AGG Intronic
No off target data available for this crispr