ID: 1049060069

View in Genome Browser
Species Human (GRCh38)
Location 8:140269853-140269875
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049060061_1049060069 21 Left 1049060061 8:140269809-140269831 CCAAGGATGGTCGGGCACGGTCG 0: 1
1: 0
2: 2
3: 20
4: 114
Right 1049060069 8:140269853-140269875 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1049060063_1049060069 -8 Left 1049060063 8:140269838-140269860 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1049060069 8:140269853-140269875 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr