ID: 1049062570

View in Genome Browser
Species Human (GRCh38)
Location 8:140287311-140287333
Sequence AGCAAGAAGGAGCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049062565_1049062570 -8 Left 1049062565 8:140287296-140287318 CCTCTGAGGAGTTCCAGCAAGAA 0: 1
1: 0
2: 1
3: 14
4: 202
Right 1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG No data
1049062561_1049062570 28 Left 1049062561 8:140287260-140287282 CCCTCTGCAAAGGGGAGATTCAG 0: 1
1: 0
2: 1
3: 19
4: 329
Right 1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG No data
1049062564_1049062570 -7 Left 1049062564 8:140287295-140287317 CCCTCTGAGGAGTTCCAGCAAGA 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG No data
1049062562_1049062570 27 Left 1049062562 8:140287261-140287283 CCTCTGCAAAGGGGAGATTCAGC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049062570 Original CRISPR AGCAAGAAGGAGCAGGAGGA AGG Intronic
No off target data available for this crispr