ID: 1049067637 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:140330001-140330023 |
| Sequence | CCTGGGAGGCAGAAGTTGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4891 | |||
| Summary | {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1049067629_1049067637 | 17 | Left | 1049067629 | 8:140329961-140329983 | CCAGCTAACTCAGGAGGCTGAGG | 0: 37 1: 170 2: 542 3: 7700 4: 121102 |
||
| Right | 1049067637 | 8:140330001-140330023 | CCTGGGAGGCAGAAGTTGCAGGG | 0: 18 1: 262 2: 800 3: 1509 4: 2302 |
||||
| 1049067626_1049067637 | 26 | Left | 1049067626 | 8:140329952-140329974 | CCTGTAATTCCAGCTAACTCAGG | 0: 2 1: 31 2: 111 3: 405 4: 2188 |
||
| Right | 1049067637 | 8:140330001-140330023 | CCTGGGAGGCAGAAGTTGCAGGG | 0: 18 1: 262 2: 800 3: 1509 4: 2302 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1049067637 | Original CRISPR | CCTGGGAGGCAGAAGTTGCA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||