ID: 1049067637

View in Genome Browser
Species Human (GRCh38)
Location 8:140330001-140330023
Sequence CCTGGGAGGCAGAAGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049067629_1049067637 17 Left 1049067629 8:140329961-140329983 CCAGCTAACTCAGGAGGCTGAGG 0: 37
1: 170
2: 542
3: 7700
4: 121102
Right 1049067637 8:140330001-140330023 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1049067626_1049067637 26 Left 1049067626 8:140329952-140329974 CCTGTAATTCCAGCTAACTCAGG 0: 2
1: 31
2: 111
3: 405
4: 2188
Right 1049067637 8:140330001-140330023 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049067637 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG Intronic
Too many off-targets to display for this crispr