ID: 1049068371

View in Genome Browser
Species Human (GRCh38)
Location 8:140337672-140337694
Sequence TAGGCAGCCCATTTTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049068371_1049068383 25 Left 1049068371 8:140337672-140337694 CCCCCACCAAAATGGGCTGCCTA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1049068383 8:140337720-140337742 GGTGCTGTGAGAGTGGCTGTGGG No data
1049068371_1049068382 24 Left 1049068371 8:140337672-140337694 CCCCCACCAAAATGGGCTGCCTA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1049068382 8:140337719-140337741 CGGTGCTGTGAGAGTGGCTGTGG No data
1049068371_1049068381 18 Left 1049068371 8:140337672-140337694 CCCCCACCAAAATGGGCTGCCTA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1049068381 8:140337713-140337735 GATCAGCGGTGCTGTGAGAGTGG No data
1049068371_1049068378 -10 Left 1049068371 8:140337672-140337694 CCCCCACCAAAATGGGCTGCCTA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1049068378 8:140337685-140337707 GGGCTGCCTAGGTGTCAGATGGG No data
1049068371_1049068380 4 Left 1049068371 8:140337672-140337694 CCCCCACCAAAATGGGCTGCCTA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1049068380 8:140337699-140337721 TCAGATGGGCACGTGATCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049068371 Original CRISPR TAGGCAGCCCATTTTGGTGG GGG (reversed) Intronic
905012913 1:34759289-34759311 AACGCATCCCATTCTGGTGGTGG - Intronic
905420604 1:37840990-37841012 CAGGCAGCCCAGCTTGGTGATGG - Intronic
905671817 1:39795976-39795998 TAGGCAGCACAAGTTGGAGGAGG - Intergenic
905865759 1:41375721-41375743 CAGGCAGCCCTTGTGGGTGGGGG + Intronic
909215395 1:72880978-72881000 TAGACATTCCCTTTTGGTGGTGG - Intergenic
913110026 1:115649302-115649324 AAGGCAGCCTATTATGGTGGGGG - Intronic
916074940 1:161195191-161195213 TAGCCAGCCCATTCCAGTGGTGG + Intronic
917258415 1:173141130-173141152 AAGGTAGCCCATGTTGCTGGAGG + Intergenic
917505470 1:175623435-175623457 TGGGCATCCCAATTTGTTGGAGG + Intronic
918274699 1:182942458-182942480 CAGGCAGCCCAGTTTCGCGGAGG - Intronic
918823692 1:189294002-189294024 TATGCATCACATTTTGGTGCAGG + Intergenic
924553413 1:245098892-245098914 TAGGCACACCATTTTTGTGAAGG - Intronic
1063541270 10:6936680-6936702 CAGGCAGCTCATTCTGGTGAGGG - Intergenic
1073065013 10:100753139-100753161 TAGGCTGCCCGTGTTGTTGGTGG - Intronic
1075339401 10:121633363-121633385 TGGGCAGCCCTTTCTGGAGGTGG - Intergenic
1076691459 10:132225707-132225729 TGGGCAGCCCAGGTGGGTGGTGG - Intronic
1077220630 11:1413922-1413944 GAGGCAGCCCATTTTCCTCGGGG - Intronic
1078131364 11:8616803-8616825 CTGGCAGCCCTTTTTGTTGGAGG - Exonic
1080318694 11:30980546-30980568 TTGGAAGCCCATTGTGGTGTTGG + Intronic
1083482957 11:62961457-62961479 CAGGAAGCCCATTGTGGGGGAGG + Intronic
1088733976 11:112709940-112709962 CAGTCAGCCCAGTGTGGTGGTGG - Intergenic
1089384726 11:118060186-118060208 TAGGCAGGCCACATGGGTGGGGG - Intergenic
1090750963 11:129746187-129746209 TTGGCATTCAATTTTGGTGGGGG - Intergenic
1097808581 12:63992522-63992544 GAGGCAGCTCCCTTTGGTGGAGG + Intronic
1097896930 12:64834090-64834112 CATGGAGCCCATTTTCGTGGGGG - Intronic
1099888721 12:88563506-88563528 GATGCAGCCTATTTTGGGGGAGG - Intronic
1102658193 12:114501531-114501553 TAGGCAGCTGATTTTGGATGAGG + Intergenic
1103383591 12:120514250-120514272 TAGGCAGCTCCTTCTGGGGGTGG + Intronic
1104878621 12:132053851-132053873 GAGGCAGCTCCTTTTAGTGGAGG + Intronic
1107784019 13:43936246-43936268 TAGGCATTCCAATTTGTTGGTGG - Intergenic
1109537357 13:63738420-63738442 AAGGCCGCCCATTTTGGGGTGGG - Intergenic
1109546021 13:63839656-63839678 AAGGCTGCCCATTTTGGGGTGGG + Intergenic
1119133529 14:72196047-72196069 TAGGGAGGCCATTTTAGTAGTGG + Intronic
1121252589 14:92511072-92511094 TGAGCAGCCCCTTTTGGTTGTGG - Intergenic
1124241630 15:28033048-28033070 CAGGCAGGCCAGTGTGGTGGAGG - Intronic
1125159106 15:36622884-36622906 TGGGGAGGCCATTTTGATGGGGG + Intronic
1128689847 15:69715298-69715320 AAGGAAGACAATTTTGGTGGTGG + Intergenic
1130819261 15:87476893-87476915 TAGGCAACTCATTTTGATGTTGG - Intergenic
1138232498 16:55349068-55349090 GAGGCAGCCCAGTCTGGTGTTGG - Intergenic
1141101251 16:81198993-81199015 TAGCGAGCCCTTTTGGGTGGTGG + Intergenic
1144250000 17:13406777-13406799 AAGGCAGCCCTTCTTGGGGGAGG + Intergenic
1144812691 17:18010808-18010830 CAGGCAGCCCAGCTTGGTGATGG - Intronic
1145989930 17:29073338-29073360 TAGGCAGCTCATTTTGGGGCAGG - Intergenic
1151551091 17:74822909-74822931 CTGGCAGCCCCTTTTGGGGGAGG + Intronic
1152502627 17:80722890-80722912 AAGGCAGCCAATGTGGGTGGGGG - Intronic
1153108815 18:1559977-1559999 TCCTGAGCCCATTTTGGTGGTGG - Intergenic
1154032012 18:10761769-10761791 TAAGCAGCCCATTTTCTTTGTGG - Intronic
1155322448 18:24632384-24632406 CAAGAAGCCCTTTTTGGTGGAGG + Intergenic
1159837676 18:73358858-73358880 TAGGCTTGCCATTGTGGTGGAGG - Intergenic
1160390734 18:78529904-78529926 TAGGCAGCACAGTTTGGTCAAGG - Intergenic
925072894 2:984977-984999 TAGGCTGCACAATTTGCTGGGGG + Intronic
925600792 2:5607072-5607094 TCGGCAGCCCATTCCAGTGGAGG - Intergenic
931648756 2:64450030-64450052 TAGGAAACCCTTTTTTGTGGGGG - Intergenic
934867614 2:97827170-97827192 AAGGCAGCCCAGTTTCGTGAAGG + Intronic
936146633 2:109984797-109984819 TTGGCAGCCCATTCCTGTGGCGG + Intergenic
936198059 2:110386682-110386704 TTGGCAGCCCATTCCTGTGGCGG - Intergenic
939700521 2:145385671-145385693 TGGGCATCTCATTCTGGTGGAGG - Intergenic
942405067 2:175645469-175645491 TAAGCATTTCATTTTGGTGGGGG + Intergenic
942828332 2:180207870-180207892 TAGGCAACCCATTCTAGTGTTGG + Intergenic
945500168 2:210562928-210562950 CAGGCAGAACATTTTAGTGGTGG + Intronic
946455651 2:219823741-219823763 TAGGCAGCTCATTCTGGCAGCGG + Intergenic
947000162 2:225445709-225445731 TGAGCAGCCCAATTTGGTGCTGG + Intronic
1169563205 20:6824401-6824423 TAGACAACCCATTTTGGTTCTGG + Intergenic
1172794770 20:37529035-37529057 TAGGCAGACCAGTTAGGAGGTGG + Intergenic
1173600054 20:44288353-44288375 CAGGAAGCCCATTTCAGTGGTGG + Intergenic
1174736615 20:52971857-52971879 TGGGGAGCACATTTTGGTGGGGG + Intergenic
1175055129 20:56190998-56191020 AAGCCAGCCCATGTTGGTGTAGG - Intergenic
1175506188 20:59486044-59486066 TTGGCAGACCTTTTTGGTAGAGG + Intergenic
1178008754 21:28257371-28257393 AAGCCAGTCCATTTTGGTGTTGG + Intergenic
1180065631 21:45410825-45410847 CCGGCAGCCCATCTTGGTGGCGG + Intronic
1180700116 22:17776843-17776865 TAGCCAGCCAATCATGGTGGTGG - Intergenic
1181069474 22:20323573-20323595 CACACAGCCCATTTTGCTGGTGG - Intergenic
1181367714 22:22391434-22391456 CAGGGAGCCCAGTTTGGTGAAGG - Intergenic
1181489684 22:23253860-23253882 AGGGCAGCCCATCTTGGTGCCGG - Exonic
1181682263 22:24503619-24503641 TGGGCAGCCCAGTCTGCTGGTGG - Intronic
1182285532 22:29244890-29244912 TAGGAAGCTCTTTTTGGCGGTGG + Intronic
1182810239 22:33110101-33110123 TAGTCAGACAGTTTTGGTGGTGG - Intergenic
1184175699 22:42787580-42787602 GAGGCGGCGCATTTTGGAGGGGG + Intergenic
1184856601 22:47149843-47149865 AAGGCATCCCATTAAGGTGGAGG - Intronic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
950530555 3:13550189-13550211 TGGGGAGCCGATTTTGGAGGAGG + Intronic
951583904 3:24195722-24195744 GAGGCAGCCCATGTGGCTGGAGG - Intronic
952568723 3:34687340-34687362 TAGGCCCCACATTTTGGAGGAGG - Intergenic
954263950 3:49459309-49459331 TAGGCAGCCCACGTCTGTGGTGG + Intergenic
957185648 3:76938360-76938382 TATGCAGCCTTTTTTGGGGGGGG - Intronic
968085461 3:195872081-195872103 TAGGAAGCCCAGCCTGGTGGGGG - Intronic
974138543 4:57851498-57851520 TTGGTAGCCCATTTTTATGGTGG - Intergenic
988063163 5:26199940-26199962 CAGGCTGCCCATATTGGTGATGG + Intergenic
993783997 5:92106147-92106169 CAGGCAGCCCCTTTTGGGGAAGG + Intergenic
997990362 5:138540049-138540071 TAGTGAGCCCATTTTGCAGGTGG + Intronic
999188268 5:149729046-149729068 AAGGGAGCCCATGATGGTGGAGG + Intergenic
1004133732 6:12946381-12946403 TAGGAAGCCAATTCTGGTGGCGG + Intronic
1005623314 6:27639916-27639938 TACTTAGCCCCTTTTGGTGGTGG - Intergenic
1006933760 6:37703388-37703410 TGGGCACCCCATTGTGCTGGAGG + Intergenic
1007619353 6:43202713-43202735 CAGGCAGCTCACTTTGCTGGTGG + Exonic
1007668794 6:43534495-43534517 CAGGTAGGTCATTTTGGTGGGGG - Intronic
1016270215 6:142279960-142279982 TTGGCAGCCCATTTTGATGAGGG + Intergenic
1021246533 7:18269804-18269826 TAGGCAGCCCAACTAGGAGGAGG - Intronic
1022248910 7:28587524-28587546 TAAGCAGACCATTGTGGAGGTGG + Intronic
1023485496 7:40681924-40681946 TAGGCAGATCTGTTTGGTGGGGG + Intronic
1024447360 7:49496960-49496982 TATTCAGTGCATTTTGGTGGAGG + Intergenic
1024872108 7:53976102-53976124 TTTGCAGCACATTTTTGTGGGGG + Intergenic
1027730327 7:81863523-81863545 AAGGTAGCCCAATTTGGTGGAGG + Intergenic
1028180023 7:87708724-87708746 TAGGCTGGTCAGTTTGGTGGTGG + Intronic
1031532083 7:122887017-122887039 TAGGCAGCCGATTCGGGTTGGGG - Intergenic
1031665761 7:124480702-124480724 CAGGCGGCCCATCTTGGTGACGG - Intergenic
1040747474 8:50663005-50663027 TAGGAAGGGCATTTTGGAGGAGG + Intronic
1044768715 8:95606156-95606178 TAGTCAGCCCAGTTTAGTTGGGG + Intergenic
1047021563 8:120780236-120780258 GAGGCAAGCCAATTTGGTGGTGG - Intronic
1047540290 8:125758684-125758706 GAGGCAGCCCATTCTGTTGTAGG - Intergenic
1049068371 8:140337672-140337694 TAGGCAGCCCATTTTGGTGGGGG - Intronic
1052892999 9:33720817-33720839 TTGGCATTCAATTTTGGTGGGGG - Intergenic
1053018673 9:34679137-34679159 TGGGGAATCCATTTTGGTGGTGG + Intergenic
1054744803 9:68843628-68843650 CAGGCAGCCCCGGTTGGTGGTGG + Intronic
1055594499 9:77851301-77851323 TAGGCATCCTGTTTTGGGGGAGG - Intronic
1060069464 9:120533646-120533668 TAGCCAGGCTTTTTTGGTGGCGG + Intronic
1060293334 9:122324648-122324670 AATGGAGCCCACTTTGGTGGTGG + Intergenic
1060937986 9:127527026-127527048 AGGGCAGCCCAGTTTGGGGGAGG + Intronic
1187244364 X:17540568-17540590 TAGGCATCTGATTTGGGTGGTGG + Intronic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1190515836 X:51222948-51222970 TAGGCAGCCTCTTATGGGGGTGG - Intergenic
1193847392 X:86490952-86490974 TAGGCAGCTCCTTTGAGTGGAGG + Intronic
1195450307 X:105004115-105004137 TGGGCTGCCCTTTCTGGTGGTGG - Intronic
1196613704 X:117743273-117743295 TAGGCTGCCGATCCTGGTGGGGG - Intergenic
1197140737 X:123114901-123114923 AATGGAGCCCACTTTGGTGGTGG - Intergenic
1197893612 X:131288757-131288779 TAGGCAGCCAAAGTTGGGGGTGG - Intronic
1198601927 X:138293489-138293511 CAGGCAGCTCATTTTGGAAGTGG + Intergenic
1202195395 Y:22295188-22295210 TAGGCAGGGGATTTTGGTGTGGG - Intergenic