ID: 1049069164

View in Genome Browser
Species Human (GRCh38)
Location 8:140343890-140343912
Sequence AGCTGAGTGTGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049069154_1049069164 24 Left 1049069154 8:140343843-140343865 CCCTGAGAACTAAGTCTTACTTG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG No data
1049069156_1049069164 -9 Left 1049069156 8:140343876-140343898 CCAAATCCACACCCAGCTGAGTG 0: 1
1: 0
2: 1
3: 19
4: 264
Right 1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG No data
1049069155_1049069164 23 Left 1049069155 8:140343844-140343866 CCTGAGAACTAAGTCTTACTTGC 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049069164 Original CRISPR AGCTGAGTGTGGAGGGCAGA GGG Intronic
No off target data available for this crispr