ID: 1049069725

View in Genome Browser
Species Human (GRCh38)
Location 8:140347134-140347156
Sequence GCCCCCACCATTAGAGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049069717_1049069725 7 Left 1049069717 8:140347104-140347126 CCGCAAAGGGCACCAGCCTCTCC 0: 1
1: 0
2: 2
3: 34
4: 333
Right 1049069725 8:140347134-140347156 GCCCCCACCATTAGAGCGGGAGG No data
1049069719_1049069725 -5 Left 1049069719 8:140347116-140347138 CCAGCCTCTCCTCCAGGAGCCCC 0: 1
1: 0
2: 10
3: 110
4: 871
Right 1049069725 8:140347134-140347156 GCCCCCACCATTAGAGCGGGAGG No data
1049069720_1049069725 -9 Left 1049069720 8:140347120-140347142 CCTCTCCTCCAGGAGCCCCCACC 0: 1
1: 2
2: 9
3: 92
4: 885
Right 1049069725 8:140347134-140347156 GCCCCCACCATTAGAGCGGGAGG No data
1049069713_1049069725 30 Left 1049069713 8:140347081-140347103 CCAGGCACGCATGTTTAGCACGG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1049069725 8:140347134-140347156 GCCCCCACCATTAGAGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049069725 Original CRISPR GCCCCCACCATTAGAGCGGG AGG Intronic
No off target data available for this crispr