ID: 1049076092

View in Genome Browser
Species Human (GRCh38)
Location 8:140397207-140397229
Sequence CTGGGTTACCACTGTGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049076089_1049076092 7 Left 1049076089 8:140397177-140397199 CCATTTAGATTCAGATTAAAGTA 0: 1
1: 0
2: 1
3: 13
4: 258
Right 1049076092 8:140397207-140397229 CTGGGTTACCACTGTGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049076092 Original CRISPR CTGGGTTACCACTGTGTCAA AGG Intronic
No off target data available for this crispr