ID: 1049077150

View in Genome Browser
Species Human (GRCh38)
Location 8:140407547-140407569
Sequence CCCTTTCTTTAAAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 341}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049077150_1049077155 -6 Left 1049077150 8:140407547-140407569 CCCTCCACCTTTTAAAGAAAGGG 0: 1
1: 0
2: 0
3: 27
4: 341
Right 1049077155 8:140407564-140407586 AAAGGGCATCTCCAGTCATGAGG No data
1049077150_1049077156 -5 Left 1049077150 8:140407547-140407569 CCCTCCACCTTTTAAAGAAAGGG 0: 1
1: 0
2: 0
3: 27
4: 341
Right 1049077156 8:140407565-140407587 AAGGGCATCTCCAGTCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049077150 Original CRISPR CCCTTTCTTTAAAAGGTGGA GGG (reversed) Intronic
901720355 1:11192445-11192467 TCCTTTCTTTAAACTGTGAATGG - Intronic
902692104 1:18116434-18116456 CCCTGTCTTTTAAAAATGGAGGG + Intronic
902721267 1:18305839-18305861 TCCTTTCTGTAAAATGAGGACGG - Intronic
903245628 1:22013213-22013235 GACCTTCTTTACAAGGTGGAAGG + Intergenic
904434874 1:30487959-30487981 CACCTTCTTTACAAGGTGGCAGG + Intergenic
904506105 1:30955582-30955604 CCTTTTGTTTAAAAGGAGGTGGG - Intronic
905011680 1:34751380-34751402 TCCTTTCTTTCGAATGTGGAAGG - Intronic
905936536 1:41828471-41828493 CCCCTCCTTTAAAAGATGAATGG + Intronic
906651611 1:47516796-47516818 CCCTGCCATTAAAAGGTTGATGG - Intergenic
906988851 1:50715803-50715825 CCCTTTTTAAAAAATGTGGAGGG - Intronic
907202474 1:52739386-52739408 CCTTTTCTTTAAGAGATGGAAGG - Intronic
907574988 1:55518368-55518390 CCCTTTCTCCTAAAGTTGGAGGG - Intergenic
908115455 1:60935700-60935722 TACTTTATTTAAAGGGTGGATGG + Intronic
908427707 1:64024022-64024044 CACTTTCTTTACAAGGTGACAGG - Intronic
909868705 1:80709824-80709846 CAGTTTCTTTCATAGGTGGAGGG - Intergenic
911128130 1:94360633-94360655 CACTTTCTTCACAAGGTGGCAGG + Intergenic
911881170 1:103239931-103239953 GACTTACTTTAAAAGGTGAAGGG - Intergenic
912082582 1:105955354-105955376 ACATTTATTTAAAATGTGGAAGG + Intergenic
916384380 1:164250936-164250958 CCCTTTCTTCGAAAGGAAGAAGG + Intergenic
917416891 1:174819883-174819905 ACCTTTCATTACAAGCTGGAGGG + Intronic
918512655 1:185328365-185328387 CACTTTCTTCACAAGGTGGCAGG + Intergenic
923901929 1:238335592-238335614 TTCTGTTTTTAAAAGGTGGAGGG - Intergenic
924002576 1:239570251-239570273 CACTTTCTTCACAAGGTGGCAGG - Intronic
924096049 1:240551904-240551926 CCCTTTCTATAAAATTTGTAAGG - Intronic
1063210589 10:3877295-3877317 CCCTTACTTTAGAAGCTTGATGG + Intergenic
1064293768 10:14058907-14058929 CCCTTGGTTTAGAAGGTGGTGGG + Intronic
1064672183 10:17726892-17726914 TCATTTCTATAAAAGGTGGATGG + Intergenic
1068057571 10:52029943-52029965 GGATTTCTTTAAAAAGTGGATGG - Intronic
1068136415 10:52954243-52954265 CCCTTTCTTTGAAGGGTTTAAGG + Intergenic
1068317386 10:55364133-55364155 CCCTTTCTTCGCAAGGTGGCAGG - Intronic
1068445141 10:57111288-57111310 ATATTTCTTTAAAAGTTGGAGGG + Intergenic
1069176659 10:65297873-65297895 CCTATTTTTTAAAAGGGGGAAGG + Intergenic
1069702716 10:70438451-70438473 CCCTCTCTGTAAAAGGGAGATGG + Intronic
1071600391 10:86956043-86956065 CCCTTTCATCAAAAGGCGGAAGG + Intronic
1072279020 10:93849184-93849206 ACGTTTGTTTAAAAGGTGGCTGG - Intergenic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1073947548 10:108768311-108768333 CACCTTCTTTACAAGGTGGCAGG - Intergenic
1076001110 10:126913692-126913714 CCCTGTCTTCAAAAGGCAGATGG + Intronic
1076142369 10:128089871-128089893 CCTTTTCCTTAACAGGTGGATGG - Intergenic
1076492047 10:130868309-130868331 CTCTTTCTTCACAAGGTGGCAGG + Intergenic
1077753958 11:5005415-5005437 CCATTTCCTTAAAAGGGGGAAGG - Intergenic
1078108839 11:8375759-8375781 CACCTTCTTTACAAGGTGGCAGG - Intergenic
1078162983 11:8857867-8857889 TACTTTTTTTTAAAGGTGGAAGG - Intronic
1078703203 11:13710678-13710700 CAATTTCTTTACCAGGTGGATGG + Exonic
1079533036 11:21478125-21478147 CACTTTCTTCACAAGGTGGCAGG + Intronic
1079791764 11:24747981-24748003 CCTTTTCTTTCAAAGCTGGAAGG - Intronic
1081680865 11:45001419-45001441 TACCTTCTTTACAAGGTGGAAGG - Intergenic
1085964096 11:81499506-81499528 CGTTTTCTTTAAAAAGGGGAGGG - Intergenic
1086816367 11:91377371-91377393 CACTTTCTTTACAAGGCGGCAGG + Intergenic
1088611116 11:111578038-111578060 CACCTTCTTTACAAGGTGGTAGG - Intergenic
1090474481 11:127007183-127007205 CCCTTGCTTAAAAATGTGGATGG + Intergenic
1091084601 11:132708996-132709018 CACTTTCTTTAAAAGAAGAAAGG + Intronic
1092829208 12:12427487-12427509 CCCTTTCTTTAAGAAGAGAAGGG + Intronic
1093068329 12:14682392-14682414 CACTTTCTTCAAAAGGTGGCAGG - Intronic
1094187176 12:27657197-27657219 CTATTTTTCTAAAAGGTGGAGGG - Intronic
1094560357 12:31547307-31547329 CCCTGTCTTAAAAAGTTGGGAGG - Intronic
1096638240 12:52974873-52974895 CCCTGTCCTTGAAAGGTGTAAGG + Intergenic
1097140323 12:56897364-56897386 CACTTCCTATTAAAGGTGGAAGG + Intergenic
1097949585 12:65412861-65412883 CACTTTCTTTGCAAGGTGGCAGG + Intronic
1098345719 12:69501222-69501244 CTCATTCTTTTAAAGGGGGAGGG - Intronic
1098593055 12:72237648-72237670 CACCTTCTTTACAAGGTGGCGGG - Intronic
1099063568 12:77944474-77944496 AAATTTCTTAAAAAGGTGGAGGG + Intronic
1099199086 12:79654707-79654729 CACCTTCTTCAAAAGGTGGCAGG + Intronic
1099777464 12:87151594-87151616 CCCTTTCTTTCACGGCTGGAAGG - Intergenic
1100772406 12:97938015-97938037 CCCTTTCCACAAAAGGTGGCAGG - Intergenic
1100814697 12:98375094-98375116 ACATTTCTTTCAAATGTGGAAGG - Intergenic
1100968028 12:100034295-100034317 TCCTTTTTTTAAAAGTTGAATGG - Intronic
1101635325 12:106535693-106535715 CCCTTTCTTTCACAGCTGGGAGG - Intronic
1102014580 12:109639332-109639354 CACTTTCTTCACAAGGTGGCAGG - Intergenic
1103276456 12:119715902-119715924 TCCTTTCTTGGAAAGGTGCAAGG + Intronic
1105600373 13:21881382-21881404 CCCCTTCTATAAGAGGAGGATGG + Intergenic
1106897452 13:34319864-34319886 CACTTCCTTTAAAAGGGAGAGGG - Intergenic
1106940336 13:34770992-34771014 CCTCTTCTTTACAAGGTGGCAGG + Intergenic
1107193314 13:37616985-37617007 CACCTTCTTTACAAGGTGGCAGG - Intergenic
1107849246 13:44553681-44553703 CCCTTTTTTTAAATGGGGGTGGG - Intronic
1109029464 13:57174601-57174623 CCCTTTCTGTACAAGGTGATTGG + Intergenic
1110086185 13:71383431-71383453 CTTTTTCTATATAAGGTGGATGG + Intergenic
1110166496 13:72448929-72448951 CACCTTCTTCAAAAGGTGGCAGG - Intergenic
1110474787 13:75901278-75901300 CACTTTCTTCACAAGGTGGCAGG - Intergenic
1110881496 13:80577864-80577886 CCTTTTCTTTCACAGCTGGAAGG + Intergenic
1111350419 13:87021373-87021395 CCCAGACTTTAATAGGTGGAAGG + Intergenic
1111678335 13:91414300-91414322 CACTTTCTTCACAAGGTGGCAGG - Intronic
1111978042 13:94987950-94987972 CCCAGACTTTAAAAGCTGGAAGG + Intergenic
1112157530 13:96833857-96833879 CCCGTTCCCTAAAAGATGGAAGG - Exonic
1112477381 13:99744278-99744300 CACTTTCTTTAAAATGTTGGAGG + Intronic
1113086305 13:106572672-106572694 CACCTTCTTTACAAGGTGGCAGG - Intergenic
1114694823 14:24616839-24616861 CCCTTTCTTTTAAATCTGGGTGG - Intergenic
1114726873 14:24947129-24947151 CTCTTGCTTAAAAAGGTGAAAGG + Intronic
1114938955 14:27581470-27581492 CCCATTTTTTAAAATGTGGTTGG - Intergenic
1115618572 14:35119658-35119680 CCATCTTTTTAAAAGGTGGGTGG - Intronic
1115681305 14:35741409-35741431 CCCTTTCTTAGAAGGGGGGAGGG + Intronic
1115776188 14:36717851-36717873 TCCTCTCTTTATAAGGTTGATGG - Intronic
1116802639 14:49459144-49459166 CACTTTCTTCACAAGGTGGCAGG - Intergenic
1117016402 14:51522546-51522568 CACTTTCTTTTAAAAGTGGAAGG - Intronic
1117556533 14:56891790-56891812 TCCTTGTTTTATAAGGTGGAGGG - Intergenic
1117626803 14:57648654-57648676 ACCTTTCTTAAAAAGGAGAAAGG + Intronic
1119876981 14:78068695-78068717 CAATTTCTTTAATAGGTGTAGGG + Intergenic
1120080259 14:80208350-80208372 CCCTTTCTTAAAAGGTTGAAAGG - Intronic
1120425835 14:84347008-84347030 ATCTTTCTTCAAAAGGTGGCAGG + Intergenic
1120906674 14:89626726-89626748 ACCTTTTTTTACAAGGTGGCAGG - Intergenic
1121324612 14:93012751-93012773 CCCTGTCTTTATCAGCTGGAAGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121904246 14:97725016-97725038 CCCTATTTATAAAATGTGGATGG + Intergenic
1122667917 14:103346595-103346617 CCCACTATTTAAAACGTGGAAGG - Intergenic
1124863877 15:33470273-33470295 CTCTTTCTTTTAAAGATGGGAGG + Intronic
1125209613 15:37197868-37197890 CACTTTCTTCACAAGGTGGCAGG + Intergenic
1125591166 15:40855446-40855468 ACCTTTCTTAAAAAAGAGGATGG - Intronic
1125747811 15:42009092-42009114 ACCTTTCTTCAATAGGAGGAGGG - Intronic
1125895977 15:43301997-43302019 CCTTTTCTTTAAAACCTGGGGGG - Intronic
1126577448 15:50210702-50210724 CCCTTTCTTTAACAGCTGGGAGG + Intronic
1127761197 15:62140623-62140645 TCCTTTATCTGAAAGGTGGAGGG + Intergenic
1128049778 15:64653918-64653940 CCCTTACTCTGAAAGGTTGAAGG + Intronic
1128086780 15:64892071-64892093 CCCTTTCTGTAAAAGCAGGAGGG - Intronic
1129058026 15:72835981-72836003 CACTTTCTTTACAAGGTGGCAGG + Intergenic
1129070313 15:72945497-72945519 CACTTTCTTCACAAGGTGGCAGG + Intergenic
1129898759 15:79129516-79129538 CCTTATCTTGAAAAGCTGGAGGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130807369 15:87339566-87339588 CCCATTCCTTAAATGTTGGAAGG - Intergenic
1133078177 16:3295619-3295641 GCCTTTCTTTAAACAGTGGGAGG + Intronic
1135008424 16:18849764-18849786 CCATTTCTTGGAAAGGTGGGAGG + Intronic
1135826325 16:25731715-25731737 TCCTTTCTTTGGAATGTGGAGGG + Intronic
1137699314 16:50484912-50484934 CCCTGTCTGTAAAATGGGGAGGG - Intergenic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1143427856 17:6854199-6854221 CCTTTTCTTTCACAGGTGGGAGG + Intergenic
1145245902 17:21269123-21269145 CCCATTCTTTAAAATGGGTAGGG - Intergenic
1145386295 17:22414184-22414206 CACCTTCTTCAAAAGGTGGCAGG + Intergenic
1148706196 17:49635011-49635033 CCTTCTCTTTTAAAGTTGGAAGG - Intronic
1149040618 17:52184131-52184153 CCCTTGCTTTAAAGGGAGGAAGG + Intergenic
1149565986 17:57640955-57640977 GCCCTTGTTGAAAAGGTGGATGG - Intronic
1150155977 17:62853471-62853493 CACTTTCTTCACAAGGTGGCAGG + Intergenic
1150371986 17:64646889-64646911 GCCTTTCTTTGTAAAGTGGAAGG + Intronic
1150966309 17:69973180-69973202 CACCTTCTTTACAAAGTGGAAGG + Intergenic
1152302241 17:79501930-79501952 CCATTTATTAAAATGGTGGATGG + Intronic
1152317683 17:79590379-79590401 CCCTTTGTTTAAAAGGCACATGG + Intergenic
1152585553 17:81187997-81188019 CCCTGTCTGCAAAAGGGGGAAGG + Intergenic
1153226477 18:2903982-2904004 CCCTTTCTTAAAAAGGTATTGGG - Intronic
1153422700 18:4926200-4926222 CCCTTGCTGTAAAATGTGAAGGG + Intergenic
1157608786 18:48942964-48942986 ACCTGTCTTTAAAAGGATGAAGG - Intronic
1157737723 18:50065459-50065481 CACCTTCTTCAAAAGGTGGCAGG + Intronic
1157817110 18:50737385-50737407 GCCTTTCTTTGAAATGTGCAGGG + Intergenic
1158035194 18:53020145-53020167 GCTTTTCTTTAAAAGGTAGAAGG - Intronic
1158207641 18:55011238-55011260 CACTTTCTTCAAAAGGCGGCAGG - Intergenic
1158900895 18:61961020-61961042 CCCTTTCTGGAAAAGATGGTTGG + Intergenic
1159915531 18:74184236-74184258 ACCTTTCTTTAAGTGGTGGTGGG - Intergenic
1160416372 18:78714424-78714446 CCCTTTCTTTGCCTGGTGGAAGG - Intergenic
1161453560 19:4359563-4359585 CCCTTTCTATGCCAGGTGGAGGG - Intronic
1161615955 19:5270295-5270317 CCCTGTCTCTAAAAGGGGGGTGG - Intronic
1163497126 19:17653093-17653115 CCCTTTAGTTACAAGATGGAGGG - Intronic
1164455293 19:28401762-28401784 AGCTTTCTTGAAAAGGTGGCTGG - Intergenic
1165090824 19:33387654-33387676 CCCTGTCTTTGCCAGGTGGATGG + Intronic
1165650402 19:37482897-37482919 CACCTTCTTTACAAGGTGGCAGG - Intronic
1165651167 19:37491394-37491416 CACCTTCTTTATAAGGTGGCAGG - Intergenic
1167706773 19:51085811-51085833 TCCTTTCTTTAAAGGGTGGCAGG + Intergenic
1168182316 19:54670721-54670743 CCCTTTCTGTAGGAGGAGGATGG - Intronic
1168693134 19:58389160-58389182 CACTTTCTTTTAATGGAGGAAGG - Intronic
1168724238 19:58572065-58572087 CTCTCTCTTTACCAGGTGGATGG + Intronic
925490632 2:4389190-4389212 CACTTTCTTCACAAGGTGGCAGG - Intergenic
926264512 2:11302840-11302862 GCCTCATTTTAAAAGGTGGAGGG - Intronic
926504800 2:13700163-13700185 CACTTTCTTCCCAAGGTGGAAGG - Intergenic
926638358 2:15207722-15207744 CACCTTCTTCAAAAGGTGGCAGG - Intronic
929420250 2:41783044-41783066 CCTTTTCTATAAAATGAGGAGGG - Intergenic
929472776 2:42212419-42212441 CCTTTTCTTTAAAACGCTGAAGG - Intronic
932370310 2:71181743-71181765 AACTTTCTTGAAGAGGTGGATGG - Intergenic
933692364 2:85189437-85189459 CCTTTTCTTTAAGAGCAGGATGG - Intronic
934120214 2:88831180-88831202 CCCTTTGTTTAAAATGTCCAGGG - Intergenic
934669457 2:96200843-96200865 ACCTTTCTTTAAATGTTGCAGGG - Intronic
934748922 2:96779262-96779284 TTCTTTCTTTAAAAGCTGTATGG + Intronic
935324835 2:101926479-101926501 CACTTTCTTCACAAGGTGGCAGG - Intergenic
936906870 2:117546451-117546473 CACTTTCTTCACAAGGTGGCAGG - Intergenic
937786472 2:125905046-125905068 CCCCTTCTTTATAGGGTGGCAGG - Intergenic
939797061 2:146658149-146658171 TCCTTTCTTTAGAAGGTAAAGGG - Intergenic
940403185 2:153269802-153269824 TACTTTCTTTACAAGGTGGCAGG + Intergenic
940940213 2:159551167-159551189 CACTTTATTTAAAAGGTTGCCGG + Intronic
941388019 2:164877262-164877284 CCTTCTCTTTGAAAGGTTGAGGG - Intergenic
942888508 2:180958693-180958715 TCCTATTTTTAAAAGGAGGAAGG + Intergenic
943124650 2:183781702-183781724 CACCTTCTTCAAAAGGTGGCAGG - Intergenic
944804993 2:203272082-203272104 CCTTTTCTCTAAAAGGAGTAGGG - Intronic
944972290 2:205007173-205007195 CACTTTCTTCACAAGGTGGCAGG - Intronic
945482629 2:210361093-210361115 CCTTTTCTTTCACAGCTGGAAGG - Intergenic
948202399 2:236138829-236138851 CCTTTACTTTAAAATGTGGCTGG - Intergenic
1169355778 20:4903919-4903941 CCCTTTCTTTGAAATGTGCGGGG - Intronic
1171141569 20:22748151-22748173 CACTTGCTTCAAGAGGTGGAGGG - Intergenic
1172727304 20:37055262-37055284 CAGTTGCTTTAACAGGTGGAGGG + Intronic
1172952507 20:38730976-38730998 TCCCGTCTTTAAAAGGTCGAAGG + Intergenic
1173336693 20:42117813-42117835 TCCTTTCTTTTTAAGATGGAAGG + Intronic
1174857703 20:54062877-54062899 CCTGTTCTTTAAAAGGTTGATGG - Intronic
1175169297 20:57068813-57068835 CCCTATCTGTAAATGGAGGAGGG + Intergenic
1175317748 20:58062662-58062684 CCATTTCTTTAATAGATAGAGGG - Intergenic
1175700525 20:61133504-61133526 CCCTGTCTTTAAAATAAGGAAGG - Intergenic
1177560488 21:22744509-22744531 CACCTTCTTTACAAGGTGGTGGG + Intergenic
1177921510 21:27158293-27158315 CCCTTATTTTAAAAGGTGTGAGG - Intergenic
1178149330 21:29776022-29776044 CACCTTCTTTACAAGGTGGCAGG + Intronic
1181778707 22:25178067-25178089 CCCTTGCTGTAAAATGTGAAGGG - Intronic
1181794823 22:25299233-25299255 CCCTTCCTGTAGAAGGTGGTTGG - Intergenic
1182815413 22:33158502-33158524 GCCTTTCTTTCAAAGCTAGAGGG - Intergenic
949611905 3:5711482-5711504 CACTTTCTTTATAAGGTGGCAGG + Intergenic
950160139 3:10754260-10754282 CCCTTCCTTTAAAAGTCAGAAGG - Intergenic
951383429 3:22014206-22014228 CCTTTTTTTTTAAAGGGGGAAGG + Intronic
952922502 3:38295616-38295638 CCCTGGCTTTTAAAGGTGTAGGG + Intronic
953591518 3:44260082-44260104 CCCCTTCTTCACAAGGTGGCAGG - Intronic
953673313 3:44980676-44980698 CCCTTTCTCTAAAAGCTTGTGGG + Intronic
954530172 3:51311688-51311710 CCCTGCCTATAAAAGGTGGTAGG - Intronic
957016442 3:75069727-75069749 CCCTTTCTTTCACAGCTGGGAGG - Intergenic
957725362 3:84058129-84058151 CCCATTCTGTAAGATGTGGAAGG + Intergenic
958493097 3:94803344-94803366 CCCTTGCTTCAACGGGTGGAGGG + Intergenic
959141167 3:102487869-102487891 CACTTTCTTCACAAGGTGGCAGG - Intergenic
959330599 3:104999707-104999729 ACCTTTTTTTACAAGGTGGTAGG - Intergenic
959507271 3:107170294-107170316 CACTTTCTTCACAAGGTGGCAGG - Intergenic
962122234 3:132574074-132574096 CATTAACTTTAAAAGGTGGAAGG + Intronic
962994423 3:140611408-140611430 CCCTGTCTTTGGAAGGTGAATGG - Intergenic
964689982 3:159439354-159439376 CACTTTCTTCAAAAGGCGGCAGG + Intronic
964970097 3:162549686-162549708 CACCTTCTTTACAAGGTGGCAGG + Intergenic
965249886 3:166329252-166329274 CACCTTCTTTACAAGGTGGCAGG + Intergenic
965881830 3:173396569-173396591 CCTGTTTTTTAAAAGGGGGAGGG + Intronic
966282220 3:178245217-178245239 CCTTTCATTTAAAAGGTGGCAGG + Intergenic
966868078 3:184272306-184272328 CCCTGTCTCTAAAAATTGGAAGG + Intronic
967260007 3:187632809-187632831 CCCTTTCTTTCAAAGGAAAATGG + Intergenic
967925005 3:194639119-194639141 TCCTTTCTGTAAAAGGAGGAAGG + Intergenic
970188437 4:13486243-13486265 CCTTTTTTTTAAATGGTGGGGGG - Intergenic
970668396 4:18365935-18365957 CCCTTTATTTAAAAGTTTGATGG + Intergenic
970770067 4:19601688-19601710 CACTTTCTTCACAAGGTGGTAGG + Intergenic
972300912 4:37784877-37784899 CCTTTGCTTTCACAGGTGGAGGG + Intergenic
973930212 4:55784988-55785010 CACCTTCTTTACAAGGTGGCAGG - Intergenic
974746527 4:66084898-66084920 CACCTTCTTCACAAGGTGGAAGG - Intergenic
975257251 4:72252722-72252744 CACTTTCTTTCCAAGGTGGCAGG - Intergenic
976070259 4:81232314-81232336 CACCTTCTTTACAAGGTGGCAGG - Intergenic
976299155 4:83501629-83501651 ACCTTTCATTAGAAGGAGGAAGG - Intronic
976303590 4:83537478-83537500 CCCTCTCTGTAAAAGGGGGTTGG - Intronic
976568460 4:86580200-86580222 CCCTTTGTATAAAAGTTGGCCGG + Intronic
977549932 4:98430179-98430201 CCCTTTTAGGAAAAGGTGGATGG + Intronic
978809899 4:112838217-112838239 CACTTTCTTCACAAGGTGGCAGG - Intronic
979894050 4:126135472-126135494 CACCTTCTTCACAAGGTGGAAGG - Intergenic
980028955 4:127802887-127802909 CTCTTTCATTATAAGGTGGGTGG - Intronic
980344692 4:131597952-131597974 CCCTTTATGTAAAAGGTTGCAGG - Intergenic
980439072 4:132817444-132817466 CCCTGTCTTTTAAAGGAGTAGGG + Intergenic
981294944 4:143120998-143121020 CACTTTCTTCACAAGGTGGCAGG - Intergenic
981393918 4:144223532-144223554 CCCTTTGTTTTAAAAGTGGAAGG + Intergenic
983349395 4:166568789-166568811 AAATTTCTTTAAAAGGTGGAAGG + Intergenic
986557803 5:9028400-9028422 ACCCTTCTTTAAAAGGTGGCAGG - Intergenic
987210579 5:15677931-15677953 CCCTTTCTTAGGAAGGTGAAAGG - Intronic
987891265 5:23881619-23881641 CCCTCCCTTGAAAAGGGGGATGG - Intergenic
988701486 5:33679430-33679452 CACCTTCTTCACAAGGTGGAAGG + Intronic
989659050 5:43779211-43779233 CACCTTCTTTACAAGGTGGCAGG + Intergenic
990970926 5:61505366-61505388 CCCTCTCTTGAAAAGGAGGAGGG + Intronic
991503865 5:67304246-67304268 TCCTTACTCTAAAAGATGGATGG + Intergenic
992556583 5:77909465-77909487 CACCTTCTTTACAAGGTGGTTGG + Intergenic
992785853 5:80169984-80170006 CCATTTCTTTAAAGGGGAGAAGG + Intronic
992787067 5:80180617-80180639 CCATTTCTTTAAAGGGGAGAAGG + Intronic
992959301 5:81942271-81942293 CACTTTCTTTACAAGGTGACAGG + Intergenic
993043371 5:82840341-82840363 CCCTTTCTTTCCATTGTGGAAGG - Intergenic
993520595 5:88894954-88894976 CCCTTTTTGTAAAATGGGGAAGG + Intronic
993668543 5:90731228-90731250 CACCTTCTTTACATGGTGGAGGG + Intronic
993901410 5:93585944-93585966 CCCTTTATTTAAAATGGGGGAGG + Intronic
996504118 5:124250092-124250114 CCTTTTCTTTAATAAGTTGAAGG + Intergenic
996779108 5:127164896-127164918 CCCTGTCATTAAATGGTGCATGG - Intergenic
996891409 5:128425319-128425341 CCCTTTATTTAAAATGTTTAGGG - Intronic
997965755 5:138354362-138354384 CGCTTTCTTTAAAAGATGGCTGG + Intronic
999082925 5:148861237-148861259 CACTTTCTTCACAAGGTGGCAGG + Intergenic
999811429 5:155131196-155131218 CCCTTTCTTGCAAAGGCAGAGGG + Intergenic
1000849146 5:166318458-166318480 CCATTTCTTTAAAGGATGGCAGG - Intergenic
1003040236 6:2681141-2681163 CCAATTCTTTACAAGCTGGAGGG + Intronic
1003472478 6:6450319-6450341 CTCTTTCTTGAAATGGTAGAGGG + Intergenic
1004602103 6:17160154-17160176 CCCGTTCTTCACAAGGTGGCAGG - Intergenic
1006816536 6:36854433-36854455 CACCTTCTTTACAAGGTGGCAGG - Intergenic
1007994725 6:46294730-46294752 GCATTTCTTTTAAAGCTGGAAGG + Intronic
1008255409 6:49293733-49293755 CACCTTCTTTACAAGGTGGCAGG - Intergenic
1009388759 6:63120296-63120318 CTCTTTCTGTAAGAGGTAGAAGG - Intergenic
1009402276 6:63271050-63271072 CCCTGTATTTAACAAGTGGAAGG + Intergenic
1009573905 6:65427105-65427127 CTTTTTCTTTAAATGGTGTAGGG + Intronic
1009791324 6:68404741-68404763 GACTTTCTTTATATGGTGGAAGG + Intergenic
1010265159 6:73857452-73857474 CCCTTTGTTTAAAATTGGGATGG - Intergenic
1010679279 6:78781026-78781048 CCTTTTCTTTAGCAGCTGGAAGG + Intergenic
1011729847 6:90249915-90249937 CCGTTTATTTAATAGGTGGTAGG + Intronic
1011761786 6:90575335-90575357 CCCTATCCTGAAAAGGGGGAGGG - Intronic
1012255182 6:97022945-97022967 CACTTTCTTCACAAGGTGGTAGG + Intronic
1013891000 6:115027137-115027159 CACTTTCTTCACAAGGTGGCAGG - Intergenic
1015001300 6:128219595-128219617 CCCCTGCTCTAAAAGGTGTAGGG + Intronic
1016679516 6:146812440-146812462 ACATTTCTTTAAAGGGGGGAAGG + Intronic
1016680084 6:146819352-146819374 ACATTTCTTTAAAGGGGGGAAGG + Intergenic
1016727723 6:147394727-147394749 CACTTTCTTCACAAGGTGGTAGG + Intergenic
1016989920 6:149922011-149922033 CCCTTTCTAGAAAGGGAGGAAGG - Intronic
1017005203 6:150024473-150024495 CCCTTTCTAGAAAGGGAGGAAGG - Intronic
1018919260 6:168160074-168160096 CCCTATCTATAAAATGAGGAGGG + Intergenic
1018943566 6:168328781-168328803 CCCTTTCTTCACAAGGTGGCAGG - Intergenic
1019367595 7:642960-642982 CCCCTTCTGTAAAGGATGGATGG + Intronic
1019900104 7:4013835-4013857 CCCCTTCTTTGAAATGAGGAAGG - Intronic
1021026474 7:15673350-15673372 CATTTTCATTAAAATGTGGATGG - Intronic
1021448743 7:20761147-20761169 CCCTTTCTTTGTAAGAGGGAAGG + Intronic
1021787508 7:24165978-24166000 CACCTTCTTTACAAGGTGGCAGG - Intergenic
1022976135 7:35558466-35558488 CACTTTCTTCACAAGGTGGCAGG - Intergenic
1023788931 7:43736725-43736747 CCCTTCCTCTCATAGGTGGATGG - Intergenic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1024445515 7:49473695-49473717 CACCTTCTTTACAAGGTGGCAGG + Intergenic
1027503943 7:78991143-78991165 CACCTTCTTTACAAGGTGGCAGG - Intronic
1027953753 7:84854474-84854496 CACCTTCTTTACAAGGTGGTAGG + Intergenic
1028166047 7:87539376-87539398 CCTTTTATTTAAATGGTGGCTGG - Intronic
1028893459 7:96014175-96014197 CCCTTTCTTTAATGGCTGTAGGG - Intronic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030152735 7:106422933-106422955 CACCTTCTTTACAAGGTGGCAGG + Intergenic
1030963708 7:115961483-115961505 CCCTTTTTTTAAAAGAATGATGG - Intronic
1031415730 7:121494560-121494582 CACTTTCTTAAAAATGTGAATGG - Intergenic
1031521639 7:122773827-122773849 TCATTTCTTTAAAATGTGAAAGG - Intronic
1031661860 7:124435700-124435722 TACCTTCTTTACAAGGTGGAAGG + Intergenic
1032150119 7:129421631-129421653 CCGTTTCTTTATTAGGTAGATGG - Intronic
1032864858 7:135915222-135915244 CCCATTTTTCAAAAGGTGTATGG + Intergenic
1033063117 7:138127025-138127047 ACCTTTCTTTGGAAGGTGCAGGG - Intergenic
1034761029 7:153671899-153671921 CCATGTCTATAAAACGTGGAGGG + Intergenic
1036673387 8:10808387-10808409 CTCTTTCTTTAAAAGCTGTTTGG + Intronic
1036795589 8:11754221-11754243 CCCTATCTTCAAAAGGTGTGAGG - Intronic
1038636558 8:29292236-29292258 TCCTGTCTTTGAAAGGTGGGGGG + Intergenic
1040711581 8:50195366-50195388 CCTTTTCTTTCACAGCTGGAAGG - Intronic
1042366431 8:67942034-67942056 TCCTTTCTTTAATGGGTTGAAGG - Intergenic
1042371106 8:67991499-67991521 CACCTTCTTTACAAGGTGGGAGG + Intronic
1042981984 8:74540159-74540181 CACCTTCTTTACAAGGTGGCAGG + Intergenic
1044773661 8:95664649-95664671 CACTTTCTTCACAAGGTGGCAGG + Intergenic
1044781682 8:95750082-95750104 TCCTTTCCATACAAGGTGGATGG - Intergenic
1044867086 8:96582165-96582187 CCATTTCTTTAAAAGTTGCTTGG + Intronic
1045849155 8:106672834-106672856 CACCTTCTTTACAAGGTGGCAGG - Intronic
1046568679 8:115934552-115934574 CTCTGTCTTTAAATTGTGGAAGG - Intergenic
1047411596 8:124628794-124628816 CCCCATCTTTAAAATGAGGATGG - Intronic
1047617350 8:126573657-126573679 CCCTGTCTTTATATGGTGGATGG - Intergenic
1049077150 8:140407547-140407569 CCCTTTCTTTAAAAGGTGGAGGG - Intronic
1049795642 8:144496192-144496214 CCCTTTCTGGAAAGGGTGGGTGG + Intronic
1050600561 9:7246147-7246169 CACCTTCTTTACAAGGTGGCAGG + Intergenic
1050996988 9:12232890-12232912 CACTTTCTTTACATGGTGGCAGG + Intergenic
1051614731 9:18996280-18996302 CCCTGTCATTAAGTGGTGGATGG - Intronic
1051838430 9:21366595-21366617 TCCTTCCCTTTAAAGGTGGAAGG + Intergenic
1052427419 9:28323759-28323781 CACCTGCTTTAAAAGGTAGACGG + Intronic
1052540811 9:29809766-29809788 CACCTTCTTCAAAAGGTGGCAGG - Intergenic
1052736668 9:32349580-32349602 CCCTCTCTTTACAAGAAGGAAGG - Intergenic
1053127485 9:35594526-35594548 CTCTTTCTATAAAGGTTGGAAGG - Intergenic
1055289584 9:74768953-74768975 CCCTTTCCTTAAGGGTTGGAGGG + Intronic
1056077983 9:83061280-83061302 CCCTTACTTTCCAAGCTGGAGGG + Intronic
1056322786 9:85452345-85452367 CCCTTTCTTTCACAGCTGGGAGG - Intergenic
1057298657 9:93863859-93863881 CCCTTTCTATAGAATGGGGAGGG - Intergenic
1057598489 9:96437010-96437032 CCCTGTCTTCAAAGGGTGCACGG - Intergenic
1057696206 9:97324578-97324600 ACATTTTTTTAAAAGGTGGGTGG + Intronic
1058222813 9:102324118-102324140 ACCTTTTTTTAGAGGGTGGAAGG - Intergenic
1058648246 9:107150793-107150815 ACCTCTCTTCCAAAGGTGGAAGG + Intergenic
1060583595 9:124772047-124772069 CCCTATCTGTAAAAGGGGGTTGG + Intergenic
1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG + Intronic
1185686036 X:1929245-1929267 CAATTTCTTTAAAAGCTGTATGG + Intergenic
1186122021 X:6373577-6373599 CACCTTCTTTACAAGGTGGCAGG + Intergenic
1186864262 X:13703530-13703552 CCTTTGCTTTAAAAAGTGGTTGG + Intronic
1187015719 X:15326605-15326627 CACTTTGTTTAAAATGTGGCTGG + Intronic
1187159937 X:16754930-16754952 GCCTTTCTTTAAAAGTGTGAAGG + Exonic
1187219251 X:17308000-17308022 CCTTTTCTTTCACAGCTGGAAGG - Intergenic
1188129564 X:26414653-26414675 CGCTTTCTTCACAAGGTGGCAGG + Intergenic
1188312710 X:28637265-28637287 CCATTTATTTAAAATTTGGAGGG - Intronic
1189983607 X:46534056-46534078 CACCTTCTTTACAAGGTGGCAGG + Intronic
1190244530 X:48682591-48682613 TCCTTTCTTTAAAAAAGGGATGG + Intronic
1191725003 X:64270151-64270173 CCATTTTTTTTAAAGGTGGAGGG - Intronic
1193530667 X:82650524-82650546 CCCTGCCTTCAAAAGGGGGAAGG - Intergenic
1194129300 X:90060467-90060489 CACTTTCTTAACAAGGTGGCAGG - Intergenic
1196059716 X:111394886-111394908 CCTTTTCTTTACACTGTGGATGG - Intronic
1196767602 X:119262382-119262404 CCCTACCTCCAAAAGGTGGAAGG - Intergenic
1196818873 X:119687073-119687095 CCCTTTATTTAATGGGTGTAGGG - Intronic
1196950299 X:120870099-120870121 CCCTGTCTGTAACAGGGGGAAGG + Intergenic
1197066286 X:122237516-122237538 CCCTTTCTTTCACAGCTGGGAGG - Intergenic
1198076464 X:133198015-133198037 CCCTTTCTAAAAGAGGTTGAAGG + Intergenic
1198096796 X:133388172-133388194 CCCTTACTTTAAAAGCTTCACGG + Intronic
1198653977 X:138893449-138893471 CCCTATCTTTAAAATGGGGGTGG - Intronic
1198672312 X:139094156-139094178 TCCTTTCTTAAAAATGTGGCAGG + Intronic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199429493 X:147743028-147743050 ACCTTTCACTAAAGGGTGGAGGG + Intergenic
1199653024 X:149966698-149966720 GACGTTCTTTAAAAGGTGAAGGG - Intergenic
1200211295 X:154347760-154347782 CCCTTTAGTTAACAGGTGGCAGG - Intergenic
1201475252 Y:14374719-14374741 AGCTTTCTTTACAAGGTGGCAGG - Intergenic