ID: 1049078876

View in Genome Browser
Species Human (GRCh38)
Location 8:140425173-140425195
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049078873_1049078876 -9 Left 1049078873 8:140425159-140425181 CCTGATACAAAGGTCCCCAAGAG 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1049078876 8:140425173-140425195 CCCCAAGAGCAGAGGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr