ID: 1049084872

View in Genome Browser
Species Human (GRCh38)
Location 8:140470802-140470824
Sequence CTGATGGCAAAGCTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049084872_1049084878 15 Left 1049084872 8:140470802-140470824 CCCTGCTCCAGCTTTGCCATCAG No data
Right 1049084878 8:140470840-140470862 ATATCCCCATAAGCCAGTTCAGG No data
1049084872_1049084880 17 Left 1049084872 8:140470802-140470824 CCCTGCTCCAGCTTTGCCATCAG No data
Right 1049084880 8:140470842-140470864 ATCCCCATAAGCCAGTTCAGGGG No data
1049084872_1049084884 24 Left 1049084872 8:140470802-140470824 CCCTGCTCCAGCTTTGCCATCAG No data
Right 1049084884 8:140470849-140470871 TAAGCCAGTTCAGGGGCCCCAGG No data
1049084872_1049084886 28 Left 1049084872 8:140470802-140470824 CCCTGCTCCAGCTTTGCCATCAG No data
Right 1049084886 8:140470853-140470875 CCAGTTCAGGGGCCCCAGGAAGG No data
1049084872_1049084879 16 Left 1049084872 8:140470802-140470824 CCCTGCTCCAGCTTTGCCATCAG No data
Right 1049084879 8:140470841-140470863 TATCCCCATAAGCCAGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049084872 Original CRISPR CTGATGGCAAAGCTGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr